ID: 1031905628

View in Genome Browser
Species Human (GRCh38)
Location 7:127457423-127457445
Sequence GCTGCAGCTTGAGGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031905628_1031905635 16 Left 1031905628 7:127457423-127457445 CCTTCTCCACCTCAAGCTGCAGC No data
Right 1031905635 7:127457462-127457484 AGAATAAGTGTGCTTGAGGGAGG No data
1031905628_1031905633 12 Left 1031905628 7:127457423-127457445 CCTTCTCCACCTCAAGCTGCAGC No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905628_1031905634 13 Left 1031905628 7:127457423-127457445 CCTTCTCCACCTCAAGCTGCAGC No data
Right 1031905634 7:127457459-127457481 GAAAGAATAAGTGTGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031905628 Original CRISPR GCTGCAGCTTGAGGTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr