ID: 1031905630

View in Genome Browser
Species Human (GRCh38)
Location 7:127457430-127457452
Sequence CACCTCAAGCTGCAGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031905624_1031905630 -10 Left 1031905624 7:127457417-127457439 CCCACCCCTTCTCCACCTCAAGC No data
Right 1031905630 7:127457430-127457452 CACCTCAAGCTGCAGCCATGTGG No data
1031905622_1031905630 -5 Left 1031905622 7:127457412-127457434 CCAGCCCCACCCCTTCTCCACCT No data
Right 1031905630 7:127457430-127457452 CACCTCAAGCTGCAGCCATGTGG No data
1031905623_1031905630 -9 Left 1031905623 7:127457416-127457438 CCCCACCCCTTCTCCACCTCAAG No data
Right 1031905630 7:127457430-127457452 CACCTCAAGCTGCAGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031905630 Original CRISPR CACCTCAAGCTGCAGCCATG TGG Intergenic
No off target data available for this crispr