ID: 1031905632

View in Genome Browser
Species Human (GRCh38)
Location 7:127457445-127457467
Sequence TATTCTTTCTCTGTGCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031905632_1031905637 21 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905637 7:127457489-127457511 ACACAGTAATTGTGCGGCTTTGG No data
1031905632_1031905635 -6 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905635 7:127457462-127457484 AGAATAAGTGTGCTTGAGGGAGG No data
1031905632_1031905634 -9 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905634 7:127457459-127457481 GAAAGAATAAGTGTGCTTGAGGG No data
1031905632_1031905633 -10 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905632_1031905636 15 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905636 7:127457483-127457505 GGAAGAACACAGTAATTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031905632 Original CRISPR TATTCTTTCTCTGTGCCACA TGG (reversed) Intergenic
No off target data available for this crispr