ID: 1031905633

View in Genome Browser
Species Human (GRCh38)
Location 7:127457458-127457480
Sequence AGAAAGAATAAGTGTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031905632_1031905633 -10 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905631_1031905633 3 Left 1031905631 7:127457432-127457454 CCTCAAGCTGCAGCCATGTGGCA No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905625_1031905633 17 Left 1031905625 7:127457418-127457440 CCACCCCTTCTCCACCTCAAGCT No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905622_1031905633 23 Left 1031905622 7:127457412-127457434 CCAGCCCCACCCCTTCTCCACCT No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905629_1031905633 6 Left 1031905629 7:127457429-127457451 CCACCTCAAGCTGCAGCCATGTG No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905623_1031905633 19 Left 1031905623 7:127457416-127457438 CCCCACCCCTTCTCCACCTCAAG No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905627_1031905633 13 Left 1031905627 7:127457422-127457444 CCCTTCTCCACCTCAAGCTGCAG No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905628_1031905633 12 Left 1031905628 7:127457423-127457445 CCTTCTCCACCTCAAGCTGCAGC No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905626_1031905633 14 Left 1031905626 7:127457421-127457443 CCCCTTCTCCACCTCAAGCTGCA No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905624_1031905633 18 Left 1031905624 7:127457417-127457439 CCCACCCCTTCTCCACCTCAAGC No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031905633 Original CRISPR AGAAAGAATAAGTGTGCTTG AGG Intergenic
No off target data available for this crispr