ID: 1031905637

View in Genome Browser
Species Human (GRCh38)
Location 7:127457489-127457511
Sequence ACACAGTAATTGTGCGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031905632_1031905637 21 Left 1031905632 7:127457445-127457467 CCATGTGGCACAGAGAAAGAATA No data
Right 1031905637 7:127457489-127457511 ACACAGTAATTGTGCGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031905637 Original CRISPR ACACAGTAATTGTGCGGCTT TGG Intergenic
No off target data available for this crispr