ID: 1031907251

View in Genome Browser
Species Human (GRCh38)
Location 7:127474428-127474450
Sequence CTCAAAGAGAAGTAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031907251_1031907262 27 Left 1031907251 7:127474428-127474450 CCTTCCCCCTACTTCTCTTTGAG No data
Right 1031907262 7:127474478-127474500 AAGTCAATGCAACTGGGCTATGG No data
1031907251_1031907257 -6 Left 1031907251 7:127474428-127474450 CCTTCCCCCTACTTCTCTTTGAG No data
Right 1031907257 7:127474445-127474467 TTTGAGGAGAAGAGCTGATGTGG No data
1031907251_1031907263 28 Left 1031907251 7:127474428-127474450 CCTTCCCCCTACTTCTCTTTGAG No data
Right 1031907263 7:127474479-127474501 AGTCAATGCAACTGGGCTATGGG No data
1031907251_1031907259 20 Left 1031907251 7:127474428-127474450 CCTTCCCCCTACTTCTCTTTGAG No data
Right 1031907259 7:127474471-127474493 GAGACCAAAGTCAATGCAACTGG No data
1031907251_1031907260 21 Left 1031907251 7:127474428-127474450 CCTTCCCCCTACTTCTCTTTGAG No data
Right 1031907260 7:127474472-127474494 AGACCAAAGTCAATGCAACTGGG No data
1031907251_1031907258 -5 Left 1031907251 7:127474428-127474450 CCTTCCCCCTACTTCTCTTTGAG No data
Right 1031907258 7:127474446-127474468 TTGAGGAGAAGAGCTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031907251 Original CRISPR CTCAAAGAGAAGTAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr