ID: 1031908253

View in Genome Browser
Species Human (GRCh38)
Location 7:127485559-127485581
Sequence CTCAGGCAACTTTCAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031908253 Original CRISPR CTCAGGCAACTTTCAAATAG AGG Intergenic
904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG + Intergenic
906832806 1:49051479-49051501 CTCAGGCATATTTGAAATTGAGG + Intronic
907485914 1:54778008-54778030 CTCAGGAAACTTTCAAATCATGG - Intergenic
910300245 1:85697993-85698015 CCCAAGCTACTTTAAAATAGTGG - Intronic
910378768 1:86602455-86602477 CTCAAGAAACTTAAAAATAGAGG - Intergenic
910714965 1:90220735-90220757 TTCAGGCAAATTTTAAAAAGAGG - Intergenic
912545963 1:110452010-110452032 CTCAAACCACCTTCAAATAGGGG + Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
916392462 1:164345593-164345615 ATCAGCCAACTCTCAAAGAGAGG + Intergenic
922962651 1:229661947-229661969 CTCAGGGAGCTTTCTAGTAGAGG + Intergenic
922999054 1:229990844-229990866 CTCAAGCAACCTTGATATAGAGG - Intergenic
1063163294 10:3436601-3436623 CCCAGGCTACTATTAAATAGAGG + Intergenic
1063627607 10:7705140-7705162 CCCAGGCAAATTTCAATTGGTGG + Exonic
1064806864 10:19144990-19145012 CTGAGGCAGTTTTCAAACAGTGG - Intronic
1072796232 10:98356937-98356959 CTCAGGCAACTTACAATCATGGG + Intergenic
1073277797 10:102327661-102327683 CTCAATCAACTTACAAATAATGG - Intronic
1073528445 10:104208204-104208226 CTCAGGAAACTTTTCAATAATGG - Intronic
1074444638 10:113510241-113510263 ATCATGTAATTTTCAAATAGAGG + Intergenic
1074936880 10:118190610-118190632 CTCAGCCAGCTGTCCAATAGGGG + Intergenic
1078397483 11:10993915-10993937 CTCAGCCTACTTTCTTATAGTGG + Intergenic
1085069585 11:73531178-73531200 CTCAGGTATCTTTCAGATTGGGG - Intronic
1085274522 11:75289797-75289819 CTCAGGAAACTTTCAGAGTGGGG - Intronic
1085904788 11:80747418-80747440 CTCAGGCAACCTTCTAAAAGTGG + Intergenic
1086509552 11:87542279-87542301 CTCAGGAAACTTACAATTATGGG + Intergenic
1086943696 11:92823925-92823947 CACAGGCATATTTCAAACAGAGG + Intronic
1087943656 11:104131650-104131672 CTCTGTCAACTTACAAAGAGTGG + Intronic
1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG + Intergenic
1092544415 12:9440167-9440189 CTCAGCTCACTTTCAAATGGAGG - Intergenic
1093635109 12:21457633-21457655 CTCAGGAAACTTTCAATCACGGG + Intronic
1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG + Intronic
1095968475 12:47884906-47884928 CTCACTCGACTTTCCAATAGTGG + Intronic
1096232982 12:49907267-49907289 CTCATACAGCTTTTAAATAGAGG - Intergenic
1098524017 12:71465721-71465743 CTGAGGTAAGTTTCTAATAGAGG - Intronic
1099969221 12:89483319-89483341 CTCAGGAAACTTACAAATTGTGG - Intronic
1103822487 12:123710219-123710241 CTGAGTCCACTTTCAAATAGGGG + Intergenic
1105805678 13:23950553-23950575 CTCAGGCACCTTGGAAAGAGTGG + Intergenic
1110050552 13:70892245-70892267 CTCAGGCAACTCCCAATAAGTGG + Intergenic
1112105694 13:96236966-96236988 CTCAGGAAACTTACAATTATGGG + Intronic
1120077560 14:80176573-80176595 CTCAAGCAATTTTCAACTAGAGG + Intergenic
1129423520 15:75449549-75449571 CTAAGGCAACTCTCCAATACAGG + Intronic
1130703918 15:86213677-86213699 CCCAAGCAACTTTTAAAAAGAGG + Intronic
1131396375 15:92089861-92089883 CTCAGGCAAATTTGCAACAGAGG + Intronic
1135920872 16:26647817-26647839 CTCAGGCAACTGTAAAATCCAGG - Intergenic
1140030478 16:71334155-71334177 CCCAGGCAATTTTCAAATCCTGG - Intergenic
1140375061 16:74438753-74438775 CACAGGCAACTTTAAAATAAAGG - Intergenic
1143354445 17:6315506-6315528 CCCAGGGGACTTACAAATAGGGG - Intergenic
1148879194 17:50712681-50712703 CTCAGGAAACTTACAATTATGGG + Intergenic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1150856280 17:68756285-68756307 CTCAGGCATCTTCAAGATAGAGG - Intergenic
1155396028 18:25387677-25387699 CTCAGGAAACTTTCAATTATGGG + Intergenic
1157084879 18:44569654-44569676 GTCAGCCAACTTTTAAATAATGG + Intergenic
1158715357 18:59874490-59874512 CTCAGGCAGCTCTTAAAGAGAGG - Intergenic
1162859391 19:13494690-13494712 CTCAGGAAACTTACAAATCATGG + Intronic
1164480937 19:28610454-28610476 ATAAGGAAACTTTCAAATGGGGG + Intergenic
1165192161 19:34074048-34074070 CTCAGGCAACTGTAACATAATGG - Intergenic
1166605531 19:44139665-44139687 GTCAGTCAATTTTCAAAGAGGGG + Intergenic
1167234424 19:48305287-48305309 CTCGGGCCACCTTCAGATAGAGG - Intronic
926492741 2:13544657-13544679 CTCAGGAAACTTACAAATCATGG - Intergenic
928245242 2:29621034-29621056 CTCAGGTGGCTTTGAAATAGGGG + Intronic
928859267 2:35836291-35836313 CTCAGGAAACTTACAATTACAGG - Intergenic
931944607 2:67291125-67291147 CTCAGGCAACTTAGAAATTGTGG - Intergenic
933700445 2:85251661-85251683 CACAGGGAACTATCAAAAAGCGG - Intronic
933792105 2:85891122-85891144 CTCAGGCTACTTACAAATCCAGG + Intergenic
935372984 2:102366705-102366727 CTCAGGAAACTTACAAAAGGGGG + Intronic
939759341 2:146155068-146155090 CTCAGGAAACTTACAATTATGGG + Intergenic
941136629 2:161725690-161725712 CTCAGTCAAATTTTAAAAAGTGG + Intronic
941357212 2:164509195-164509217 CTCATCCAGCTTTCAAATAATGG + Intronic
942565301 2:177260282-177260304 TTCAGTCAACTTTCAGAAAGTGG + Intronic
943319481 2:186430835-186430857 CTCAGGAAACTTACAAATCATGG + Intergenic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
1170952877 20:20952670-20952692 CTCAGGAAACTTACAATAAGGGG - Intergenic
1173537209 20:43824652-43824674 CTCAACTAACTTTCAAATAGAGG + Intergenic
1174185989 20:48706745-48706767 ATCAGGCAACTTTCAGATGCAGG + Intronic
1177523109 21:22256021-22256043 CTAGGGCAACTTTCCAAAAGGGG + Intergenic
1178347099 21:31839399-31839421 AATAGGCAACTGTCAAATAGTGG + Intergenic
1179807765 21:43850913-43850935 CTCAGGAAACTTACAAATTGTGG + Intergenic
1183755275 22:39756133-39756155 ACTAGGCAACTTTCAAATTGTGG + Intronic
949529290 3:4938423-4938445 CTCAGCAAACTTTCCCATAGAGG + Intergenic
959050567 3:101520725-101520747 CTAAGGCAAAATTCAAATGGTGG - Intergenic
959334502 3:105046844-105046866 ATCAGATAAATTTCAAATAGTGG - Intergenic
960615169 3:119589712-119589734 CACAGGCACATTTCAAAAAGAGG + Exonic
960921489 3:122751404-122751426 ATCAGGCAACTTTAAGATACAGG - Intronic
965168968 3:165235903-165235925 CTCAGGCAAATATCTAAGAGAGG + Intergenic
966234135 3:177682003-177682025 CCCAGGCAACTTTCATTTTGTGG - Intergenic
966953717 3:184850436-184850458 CTCAGGCAACTCCCAAAAAAGGG - Intronic
968036478 3:195552190-195552212 CCCAGGCAACTCACAAATAGTGG + Intergenic
969215752 4:5720937-5720959 CACAGGGCACATTCAAATAGGGG - Intronic
969225288 4:5793083-5793105 CTCAGGCAGCTTTGAACAAGAGG + Intronic
970300214 4:14673343-14673365 CTCAGGAAACTTACAATTATAGG + Intergenic
970403963 4:15744321-15744343 CTCAGGAAACTTACAAATCACGG + Intergenic
971535244 4:27739479-27739501 TTCAGGTAACTTTTAAATTGAGG - Intergenic
971662003 4:29430569-29430591 CCCAGGAAACTTTCACACAGGGG + Intergenic
972977358 4:44652906-44652928 CTCAGTCAGCTTTCAAACATTGG - Intronic
974108179 4:57494932-57494954 CTCAGGCAACTTCCAAGAATGGG + Intergenic
974261416 4:59529984-59530006 ATCAGGCAACCTACAAAAAGGGG - Intergenic
975243298 4:72088616-72088638 TTCAGGAAACTTACCAATAGTGG + Intronic
975599743 4:76086860-76086882 TTCAGGCTACTGTCACATAGGGG - Intronic
976154391 4:82126789-82126811 CTCAGGCAACTTAAGAATAATGG - Intergenic
981866261 4:149423204-149423226 CTCAGGAAACTTACAACTGGTGG + Intergenic
984133590 4:175908612-175908634 CTAAGGCAACTTTCCTATAAAGG - Intronic
985198270 4:187456555-187456577 CTAAGGCAATTTTTAAATAAAGG + Intergenic
988366657 5:30309417-30309439 CCCAGGGAACTTTCAATTATGGG - Intergenic
990982505 5:61614790-61614812 CTCAGGGGAATTTCTAATAGTGG + Intergenic
991765108 5:69968305-69968327 CTCAGGAAACTTACAATTATAGG - Intergenic
991782217 5:70149848-70149870 CTCAGGAAACTTACAATTATAGG + Intergenic
991844340 5:70843376-70843398 CTCAGGAAACTTACAATTATAGG - Intergenic
991874660 5:71150163-71150185 CTCAGGAAACTTACAATTATAGG + Intergenic
992526789 5:77619495-77619517 CTCAAGCACCTTTCAGATAATGG - Intronic
992767232 5:80012556-80012578 CAGAGGCAAATTTCAACTAGAGG + Intronic
994411770 5:99415517-99415539 ACCAGGCAACTTCCAAATTGTGG - Intergenic
994482054 5:100349733-100349755 ACCAGGCAACTTCCAAATTGTGG + Intergenic
994968228 5:106701690-106701712 CTAAGGCAATTTTCAAAGAATGG - Intergenic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
997752377 5:136358709-136358731 CTCAGATAACTATGAAATAGAGG + Intronic
998284503 5:140846134-140846156 CTCAGGCAACTTTTAAATATGGG - Intronic
1003192373 6:3885934-3885956 CTCAGGTGACATTCAAACAGAGG - Intergenic
1006635031 6:35455961-35455983 CTCTGGCATCTTTCAGACAGTGG - Exonic
1008238038 6:49073894-49073916 CTCAGACAGCTTGCAAATAGTGG + Intergenic
1009743035 6:67772854-67772876 TTCACTCAAATTTCAAATAGAGG + Intergenic
1012628580 6:101434344-101434366 CTCAGGCAAACTCGAAATAGTGG + Intronic
1015917930 6:138236936-138236958 CTAAGCCAACTTTCAAATGTAGG + Intronic
1016989903 6:149921912-149921934 CAATGGCAACCTTCAAATAGGGG - Intronic
1016993148 6:149943150-149943172 CAATGGCAACCTTCAAATAGGGG + Intronic
1017327613 6:153158134-153158156 CTCAGGAAACTTTCAAATAAAGG - Intergenic
1021485211 7:21160371-21160393 CTCAGGCACCTTTTACATATTGG - Intergenic
1021570922 7:22064560-22064582 TTCATGCAACTAGCAAATAGTGG + Intergenic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1025184331 7:56845397-56845419 TTCAGGCTACTTTCAAATTTTGG - Intergenic
1025687597 7:63731571-63731593 TTCAGGCTACTTTCAAATTTTGG + Intergenic
1027493919 7:78863647-78863669 ATCAGGCAATTCTCAAAGAGTGG - Intronic
1028343127 7:89746878-89746900 CTGAGGCAAGTTTCAGACAGAGG - Intergenic
1028470974 7:91206092-91206114 CTCAGGAACCATTAAAATAGTGG - Intronic
1030314217 7:108097743-108097765 CTTAGGCAATTTTCAAGTGGTGG - Intronic
1031908253 7:127485559-127485581 CTCAGGCAACTTTCAAATAGAGG + Intergenic
1033913748 7:146298180-146298202 CACATTCAACTTGCAAATAGTGG - Intronic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1038252578 8:25919366-25919388 GTCAGTCAACCTTCAAAGAGAGG + Intronic
1045229320 8:100286594-100286616 CTCAAGAAACTTTTAAATAGTGG + Intronic
1045785891 8:105919549-105919571 CTCAGGCAACTTACAATAATGGG - Intergenic
1054738290 9:68779022-68779044 CGCAGGCTATTTTCAGATAGTGG - Intronic
1054766910 9:69049524-69049546 CCCTGGAAACTTTCAGATAGTGG + Intronic
1056065507 9:82929478-82929500 CTCAGGGAGCTTTCCATTAGAGG + Intergenic
1056401270 9:86229875-86229897 CTCAGGAAACTTACAATTATTGG + Intronic
1061636086 9:131909341-131909363 CTCAGGCTACCTTGAAAAAGAGG - Intronic
1062254790 9:135615785-135615807 ATGAGGCAACTTTCAAACACTGG - Intergenic
1062266778 9:135690168-135690190 CTCAGGAAACTGACAAATTGTGG - Intergenic
1186151984 X:6684916-6684938 CTCACTCAACTTTCACATAAAGG - Intergenic
1186451919 X:9681168-9681190 CTCAGGCAACTCACAAAGAACGG - Intronic
1186943980 X:14544424-14544446 CTCAGGCAGCTTTCAAAAAATGG + Intronic
1191882496 X:65856890-65856912 CTAAGCCAACTTTCAAAGAATGG - Intergenic
1194178731 X:90687548-90687570 CTCAGGAAACTTACAATTATGGG + Intergenic
1199551066 X:149061908-149061930 TTCAGGCAACTTTTAAAAATGGG + Intergenic
1199829073 X:151531050-151531072 CTCAGGAAACTTACAATCAGGGG + Intergenic
1200525397 Y:4269719-4269741 CTCAGGAAACTTACAATTATCGG + Intergenic
1201533120 Y:15014273-15014295 GGCAGGCAACATTCAAATACAGG + Intergenic
1202099318 Y:21289164-21289186 CTCAGGAAACTTTTAATCAGGGG - Intergenic