ID: 1031910030

View in Genome Browser
Species Human (GRCh38)
Location 7:127506214-127506236
Sequence CTAAATACACAGCTAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031910030_1031910031 -10 Left 1031910030 7:127506214-127506236 CCTTGCTCTAGCTGTGTATTTAG No data
Right 1031910031 7:127506227-127506249 GTGTATTTAGTTCAACATACTGG No data
1031910030_1031910032 -7 Left 1031910030 7:127506214-127506236 CCTTGCTCTAGCTGTGTATTTAG No data
Right 1031910032 7:127506230-127506252 TATTTAGTTCAACATACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031910030 Original CRISPR CTAAATACACAGCTAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr