ID: 1031910730

View in Genome Browser
Species Human (GRCh38)
Location 7:127514135-127514157
Sequence GCTCTGAGAGTACCAAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031910730_1031910735 10 Left 1031910730 7:127514135-127514157 CCTACTCTTGGTACTCTCAGAGC No data
Right 1031910735 7:127514168-127514190 CCACAAAACCACTGGGCCCAAGG No data
1031910730_1031910731 2 Left 1031910730 7:127514135-127514157 CCTACTCTTGGTACTCTCAGAGC No data
Right 1031910731 7:127514160-127514182 CACAAATCCCACAAAACCACTGG No data
1031910730_1031910732 3 Left 1031910730 7:127514135-127514157 CCTACTCTTGGTACTCTCAGAGC No data
Right 1031910732 7:127514161-127514183 ACAAATCCCACAAAACCACTGGG No data
1031910730_1031910738 26 Left 1031910730 7:127514135-127514157 CCTACTCTTGGTACTCTCAGAGC No data
Right 1031910738 7:127514184-127514206 CCCAAGGACCTGTAACACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031910730 Original CRISPR GCTCTGAGAGTACCAAGAGT AGG (reversed) Intergenic
No off target data available for this crispr