ID: 1031910863

View in Genome Browser
Species Human (GRCh38)
Location 7:127515541-127515563
Sequence ATGCTGCATTTGATGAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031910863_1031910865 -1 Left 1031910863 7:127515541-127515563 CCCTATTTCATCAAATGCAGCAT No data
Right 1031910865 7:127515563-127515585 TAACCTTCCCAGCCTTGTCATGG No data
1031910863_1031910869 8 Left 1031910863 7:127515541-127515563 CCCTATTTCATCAAATGCAGCAT No data
Right 1031910869 7:127515572-127515594 CAGCCTTGTCATGGATACTGAGG No data
1031910863_1031910871 12 Left 1031910863 7:127515541-127515563 CCCTATTTCATCAAATGCAGCAT No data
Right 1031910871 7:127515576-127515598 CTTGTCATGGATACTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031910863 Original CRISPR ATGCTGCATTTGATGAAATA GGG (reversed) Intergenic
No off target data available for this crispr