ID: 1031910961

View in Genome Browser
Species Human (GRCh38)
Location 7:127516264-127516286
Sequence ATGAAGAAACAGCCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031910961_1031910963 -8 Left 1031910961 7:127516264-127516286 CCTTCCTCAGGCTGTTTCTTCAT No data
Right 1031910963 7:127516279-127516301 TTCTTCATCTACCAGCTGAATGG No data
1031910961_1031910965 15 Left 1031910961 7:127516264-127516286 CCTTCCTCAGGCTGTTTCTTCAT No data
Right 1031910965 7:127516302-127516324 AGCAGACTCTCAAGTCTCAGAGG No data
1031910961_1031910967 24 Left 1031910961 7:127516264-127516286 CCTTCCTCAGGCTGTTTCTTCAT No data
Right 1031910967 7:127516311-127516333 TCAAGTCTCAGAGGACCACAGGG No data
1031910961_1031910966 23 Left 1031910961 7:127516264-127516286 CCTTCCTCAGGCTGTTTCTTCAT No data
Right 1031910966 7:127516310-127516332 CTCAAGTCTCAGAGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031910961 Original CRISPR ATGAAGAAACAGCCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr