ID: 1031910963

View in Genome Browser
Species Human (GRCh38)
Location 7:127516279-127516301
Sequence TTCTTCATCTACCAGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031910961_1031910963 -8 Left 1031910961 7:127516264-127516286 CCTTCCTCAGGCTGTTTCTTCAT No data
Right 1031910963 7:127516279-127516301 TTCTTCATCTACCAGCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031910963 Original CRISPR TTCTTCATCTACCAGCTGAA TGG Intergenic
No off target data available for this crispr