ID: 1031910965

View in Genome Browser
Species Human (GRCh38)
Location 7:127516302-127516324
Sequence AGCAGACTCTCAAGTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031910961_1031910965 15 Left 1031910961 7:127516264-127516286 CCTTCCTCAGGCTGTTTCTTCAT No data
Right 1031910965 7:127516302-127516324 AGCAGACTCTCAAGTCTCAGAGG No data
1031910962_1031910965 11 Left 1031910962 7:127516268-127516290 CCTCAGGCTGTTTCTTCATCTAC No data
Right 1031910965 7:127516302-127516324 AGCAGACTCTCAAGTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031910965 Original CRISPR AGCAGACTCTCAAGTCTCAG AGG Intergenic
No off target data available for this crispr