ID: 1031919972

View in Genome Browser
Species Human (GRCh38)
Location 7:127593329-127593351
Sequence CAGCTTTTATGGCCCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031919972_1031919977 29 Left 1031919972 7:127593329-127593351 CCTCCTAAGGGCCATAAAAGCTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1031919977 7:127593381-127593403 ACAAAATACTTGAGTTGCAAGGG 0: 1
1: 0
2: 0
3: 20
4: 195
1031919972_1031919976 28 Left 1031919972 7:127593329-127593351 CCTCCTAAGGGCCATAAAAGCTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1031919976 7:127593380-127593402 AACAAAATACTTGAGTTGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 243
1031919972_1031919975 -8 Left 1031919972 7:127593329-127593351 CCTCCTAAGGGCCATAAAAGCTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1031919975 7:127593344-127593366 AAAAGCTGATAGATTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031919972 Original CRISPR CAGCTTTTATGGCCCTTAGG AGG (reversed) Intronic
905256674 1:36689189-36689211 CAGCTTCTTTGACCCTCAGGTGG - Intergenic
908713169 1:67040745-67040767 CAATTTGTATGGCCCTTTGGAGG - Intronic
908764576 1:67542908-67542930 CAGATTTTATGGTTCTTAAGTGG + Intergenic
909898251 1:81100931-81100953 TAACTTGTGTGGCCCTTAGGAGG + Intergenic
911025035 1:93427031-93427053 GAGCTTTTATGGGCCTCAGAGGG - Intergenic
913213041 1:116597520-116597542 ATACTTTTATGGCCCTTTGGAGG - Intronic
919968429 1:202553284-202553306 CAGCTTTTATGGCCCAACTGGGG - Intronic
923684415 1:236143689-236143711 CAGCTTTTATGGCCTTTTCTTGG - Intronic
1062770023 10:92014-92036 GAGCTTTTATGGGCCTCAGAGGG + Intergenic
1062771423 10:104654-104676 GAGCTTTTATGGGCCTCAGAGGG + Intergenic
1068803827 10:61172454-61172476 TTGCATTTATGGCCCTTGGGAGG - Intergenic
1072691422 10:97574579-97574601 CAGCTCTGATGGCCCTGAGAAGG + Intronic
1077426858 11:2484526-2484548 CAGCTTCCATGCCCCTTTGGTGG + Intronic
1078315170 11:10288802-10288824 CAACTTTTATGGGCCTCAGAGGG + Intronic
1081536014 11:43996754-43996776 CAGCTTTGATGGGCCTTGGTGGG + Intergenic
1081580868 11:44350758-44350780 GAGCTTTTACAGTCCTTAGGAGG - Intergenic
1082814543 11:57499516-57499538 CAGCGTTTGTGGCCCCTTGGAGG - Intronic
1086925141 11:92631935-92631957 CAGCTTTTCTGGCCCTTCACTGG + Intronic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1105210771 13:18255548-18255570 CAGTTTTTATGGGACCTAGGAGG - Intergenic
1112269355 13:97954100-97954122 CAGTTTTTATTTCACTTAGGTGG + Exonic
1115767883 14:36642729-36642751 GGGCTTTAATGGCCCTTAGGTGG - Intergenic
1117973291 14:61273129-61273151 GAGGTTTTATGGCCCTTCTGTGG + Intronic
1125785619 15:42314462-42314484 GAGCTGTTATGGTCCTTGGGTGG + Intronic
1125786420 15:42322465-42322487 CAGCTTTTATGGTGGTTAGCGGG + Intronic
1126475922 15:49064982-49065004 CAGATGTTATGGCCCTGAGATGG + Intergenic
1127303735 15:57682326-57682348 CAGCTTCTCTTGCCATTAGGTGG - Intronic
1128260499 15:66229619-66229641 CAGCTTTGGTGGCCCTTCCGAGG + Intronic
1128664255 15:69526775-69526797 CAGCATTTAAGCCCCTTAGCAGG - Intergenic
1129014217 15:72451421-72451443 CAGCTCTTATGCTCCTGAGGCGG + Intergenic
1129799993 15:78406306-78406328 CGGCTTTTATGGGCCTCAGAGGG - Intergenic
1134398520 16:13887661-13887683 CAACATTTTTGGCCCTTTGGAGG - Intergenic
1137326742 16:47446183-47446205 CAGCTTATCTGTCCCTTTGGAGG - Intronic
1140144881 16:72296871-72296893 CAGATATTATGGGCTTTAGGAGG - Intergenic
1150462527 17:65364542-65364564 CAGCTGTTATGGCTCATGGGCGG - Intergenic
1153304741 18:3621302-3621324 CAGCTTTGATGAACCTTAGGAGG - Intronic
1168303432 19:55419896-55419918 GAGCTTTTATGGGCCTCAGAGGG - Intergenic
1168494440 19:56838080-56838102 CATCTTTGCTGGCCATTAGGTGG - Intronic
925048200 2:790270-790292 GAGCTTTTATGGGCCTCAGAGGG - Intergenic
925741605 2:7009801-7009823 CGGCTTGTATGGCCCTGCGGTGG + Intronic
927488007 2:23502476-23502498 CAGATTTTCTGGCCCCTAAGGGG + Intronic
934851799 2:97706717-97706739 CTGCCTTTCTGGCCCTTGGGAGG + Intergenic
939239973 2:139544911-139544933 CACTTTTTATGGCTCTTAGCAGG - Intergenic
939676148 2:145074277-145074299 TAGTTTTTATGGTCCTCAGGAGG - Intergenic
939747333 2:145992118-145992140 CATTTTTTATGGCTCTTGGGAGG - Intergenic
940320377 2:152370486-152370508 GAGCTTTTATTACCATTAGGAGG + Intronic
941709294 2:168695089-168695111 CATCTTTAATGGCCCTTAGCAGG + Intronic
944332915 2:198493746-198493768 AAGCTTTTATAGACCTTATGAGG - Intronic
1169422912 20:5474060-5474082 CTGCTTTCCTGCCCCTTAGGAGG + Intergenic
1169426515 20:5501415-5501437 CTGCTTTCCTGCCCCTTAGGAGG - Intergenic
1170112580 20:12821853-12821875 CAGCTTCCTTGCCCCTTAGGTGG - Intergenic
1170293368 20:14796059-14796081 CAGTTTTTATGAGCCTCAGGTGG + Intronic
1171077807 20:22146940-22146962 CAGCTTCTTTGTCCCTTGGGTGG - Intergenic
1172108529 20:32531326-32531348 CAGCTTGTGGGGGCCTTAGGTGG + Intronic
1177396076 21:20538032-20538054 GAGCTTTTATGGGCCTCAGAGGG + Intergenic
1181908357 22:26217716-26217738 CAGCTTATATGGCCCCAAGTGGG + Intronic
1182365007 22:29772704-29772726 CAGGTTTTAGGGCCCATATGGGG + Intergenic
1183274485 22:36884644-36884666 CAGCTTTTATTTCCCCTTGGGGG + Intergenic
1184188753 22:42881162-42881184 CTTCTTTTATGGCCCTTAACAGG - Intronic
955161611 3:56468926-56468948 CAGCTTTAATGTTCCTTAGGAGG + Intergenic
964590708 3:158360291-158360313 GGGCTTTTATGGGCCTTAGAGGG + Intronic
967693773 3:192507208-192507230 CAGCTTTTAAGGCTCTTCTGGGG + Intronic
968538659 4:1151072-1151094 GGGCTTTTATGGGCCTTAGAGGG + Intergenic
972358273 4:38303214-38303236 GGGCTTTTATGGGCCTTAGAGGG + Intergenic
975957658 4:79861089-79861111 CAGCATTTATGGCATTTAGATGG + Intergenic
979527921 4:121736925-121736947 AAGCTTTTATGGCCACCAGGTGG - Intergenic
980719473 4:136675571-136675593 CAACTTTTATAGCACTTTGGGGG - Intergenic
988404750 5:30809923-30809945 TAGTTTTTAAAGCCCTTAGGAGG - Intergenic
994453983 5:99981953-99981975 CAGCTTTTATGACCATTAATTGG + Intergenic
997609220 5:135201333-135201355 CAACTTTTATGGTTTTTAGGAGG + Intronic
1000995056 5:167950308-167950330 CAGCTTGTGTGGCCCTTGTGAGG - Intronic
1005280988 6:24273585-24273607 CAGATTTGATATCCCTTAGGAGG + Intronic
1007968563 6:46027352-46027374 CATGTATGATGGCCCTTAGGTGG + Intronic
1009604761 6:65852744-65852766 CAGCTGTGATTGCCCTTTGGTGG + Intergenic
1009932104 6:70188358-70188380 CAGCTATTATTGCCCTCACGGGG - Intronic
1013236036 6:108198658-108198680 CAGCTTTCATGGACCTCAGAGGG + Intergenic
1018659942 6:166076691-166076713 GAGCTTTTATGGACCTCAGAGGG + Intergenic
1020814816 7:12892522-12892544 CAGCCTTTGTGGTCCTTAGTGGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1031919972 7:127593329-127593351 CAGCTTTTATGGCCCTTAGGAGG - Intronic
1032417372 7:131746670-131746692 CAATATTTATGGCCCTTAGCAGG + Intergenic
1032837325 7:135686279-135686301 CAGCCTCTATGGCACTTAAGAGG - Intronic
1037553963 8:20004360-20004382 GGGCTTTTATGGGCCTCAGGGGG + Intergenic
1037623115 8:20584449-20584471 CAGCTGTTATTGCCCATGGGAGG + Intergenic
1037960770 8:23096340-23096362 CAGTTTTTATGGCCCTCTGCAGG - Intronic
1041466395 8:58161669-58161691 CAGCCTTTCTGGGCCTGAGGTGG - Intronic
1042821297 8:72932742-72932764 AAGCTCTTATGGCACTTATGTGG - Intronic
1044301686 8:90591616-90591638 AAGCTTCTCTGGCCCTTACGTGG - Intergenic
1044524952 8:93241530-93241552 AGGCTTTTATGGGCCTTAGAGGG + Intergenic
1045324944 8:101110946-101110968 CATCTTTTCTGGCCTTTAGCTGG - Intergenic
1046674648 8:117094563-117094585 GAGCTTTTATGGGCCTCAGAGGG + Intronic
1051043110 9:12839249-12839271 CTTCTTTTATGGCCCAGAGGTGG + Intergenic
1052372529 9:27681699-27681721 CAGCTATTCTGGAGCTTAGGTGG - Intergenic
1053128198 9:35599612-35599634 GGGCTTTTATGGGCCTTAGAGGG - Intergenic
1055009688 9:71551367-71551389 CAGCATTTAAGGGGCTTAGGAGG - Intergenic
1059406348 9:114100070-114100092 CAGCGTGTAGGGCCTTTAGGGGG + Intergenic
1061081362 9:128372546-128372568 CAGCATTTCTGCCCCTTAGAAGG + Intronic
1196440243 X:115713147-115713169 CAGCTGGTATGGCCCTGTGGTGG - Intergenic
1197561934 X:128034630-128034652 CAGCTTTTATGGACCTTCACTGG + Intergenic
1202304240 Y:23451257-23451279 CAGCTTTTATGGCCCAACTGGGG - Intergenic
1202566570 Y:26219334-26219356 CAGCTTTTATGGCCCAACTGGGG + Intergenic