ID: 1031921442 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:127604165-127604187 |
Sequence | CTATTTCACCACATCTACAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031921441_1031921442 | 1 | Left | 1031921441 | 7:127604141-127604163 | CCACTTCTAATTCTAGTTCTCTT | 0: 275 1: 567 2: 511 3: 378 4: 680 |
||
Right | 1031921442 | 7:127604165-127604187 | CTATTTCACCACATCTACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031921442 | Original CRISPR | CTATTTCACCACATCTACAG TGG | Intergenic | ||
No off target data available for this crispr |