ID: 1031921442

View in Genome Browser
Species Human (GRCh38)
Location 7:127604165-127604187
Sequence CTATTTCACCACATCTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031921441_1031921442 1 Left 1031921441 7:127604141-127604163 CCACTTCTAATTCTAGTTCTCTT 0: 275
1: 567
2: 511
3: 378
4: 680
Right 1031921442 7:127604165-127604187 CTATTTCACCACATCTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031921442 Original CRISPR CTATTTCACCACATCTACAG TGG Intergenic
No off target data available for this crispr