ID: 1031921773

View in Genome Browser
Species Human (GRCh38)
Location 7:127607492-127607514
Sequence CTGTGGTTTCAGGTATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031921773_1031921777 29 Left 1031921773 7:127607492-127607514 CCAGCAGATACCTGAAACCACAG No data
Right 1031921777 7:127607544-127607566 TTCCTATGCATACACACCTAGGG No data
1031921773_1031921776 28 Left 1031921773 7:127607492-127607514 CCAGCAGATACCTGAAACCACAG No data
Right 1031921776 7:127607543-127607565 TTTCCTATGCATACACACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031921773 Original CRISPR CTGTGGTTTCAGGTATCTGC TGG (reversed) Intergenic
No off target data available for this crispr