ID: 1031923204

View in Genome Browser
Species Human (GRCh38)
Location 7:127615948-127615970
Sequence CAGAAGGATGAGACTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031923198_1031923204 6 Left 1031923198 7:127615919-127615941 CCTGATGCATGCTCCAGGCTGAC 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923191_1031923204 25 Left 1031923191 7:127615900-127615922 CCCCCAGGCTCCTCACCGTCCTG 0: 1
1: 0
2: 3
3: 37
4: 312
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923197_1031923204 10 Left 1031923197 7:127615915-127615937 CCGTCCTGATGCATGCTCCAGGC 0: 1
1: 0
2: 1
3: 24
4: 212
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923193_1031923204 23 Left 1031923193 7:127615902-127615924 CCCAGGCTCCTCACCGTCCTGAT 0: 1
1: 0
2: 2
3: 13
4: 141
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923194_1031923204 22 Left 1031923194 7:127615903-127615925 CCAGGCTCCTCACCGTCCTGATG 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923199_1031923204 -7 Left 1031923199 7:127615932-127615954 CCAGGCTGACCCTCCTCAGAAGG No data
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923192_1031923204 24 Left 1031923192 7:127615901-127615923 CCCCAGGCTCCTCACCGTCCTGA 0: 1
1: 0
2: 0
3: 32
4: 289
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data
1031923195_1031923204 15 Left 1031923195 7:127615910-127615932 CCTCACCGTCCTGATGCATGCTC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031923204 Original CRISPR CAGAAGGATGAGACTCCAGC TGG Intergenic
No off target data available for this crispr