ID: 1031923663

View in Genome Browser
Species Human (GRCh38)
Location 7:127619362-127619384
Sequence CAGTCTGAGGATGCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031923663_1031923678 25 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923678 7:127619410-127619432 GAGGGTGATTTCAGGACCTCGGG No data
1031923663_1031923672 -7 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923672 7:127619378-127619400 CAGACTGGTCTTGGGGTACAGGG No data
1031923663_1031923677 24 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923677 7:127619409-127619431 AGAGGGTGATTTCAGGACCTCGG No data
1031923663_1031923675 7 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923675 7:127619392-127619414 GGTACAGGGGAGACTGCAGAGGG No data
1031923663_1031923674 6 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923674 7:127619391-127619413 GGGTACAGGGGAGACTGCAGAGG No data
1031923663_1031923676 17 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923676 7:127619402-127619424 AGACTGCAGAGGGTGATTTCAGG No data
1031923663_1031923671 -8 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923671 7:127619377-127619399 TCAGACTGGTCTTGGGGTACAGG No data
1031923663_1031923673 -6 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923673 7:127619379-127619401 AGACTGGTCTTGGGGTACAGGGG No data
1031923663_1031923679 29 Left 1031923663 7:127619362-127619384 CCTCCTCCAGCATCCTCAGACTG No data
Right 1031923679 7:127619414-127619436 GTGATTTCAGGACCTCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031923663 Original CRISPR CAGTCTGAGGATGCTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr