ID: 1031925183

View in Genome Browser
Species Human (GRCh38)
Location 7:127632156-127632178
Sequence CCAGCTAAGTAGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031925183_1031925189 5 Left 1031925183 7:127632156-127632178 CCTGCTTTACCCTACTTAGCTGG No data
Right 1031925189 7:127632184-127632206 CAGGCATGCATCACCACACCAGG 0: 195
1: 4079
2: 13330
3: 39462
4: 84264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031925183 Original CRISPR CCAGCTAAGTAGGGTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr