ID: 1031925512

View in Genome Browser
Species Human (GRCh38)
Location 7:127634623-127634645
Sequence CTTGAGGCCTAGAACTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031925512_1031925517 -6 Left 1031925512 7:127634623-127634645 CCCTGAAAGTTCTAGGCCTCAAG No data
Right 1031925517 7:127634640-127634662 CTCAAGGTGAGGAGAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031925512 Original CRISPR CTTGAGGCCTAGAACTTTCA GGG (reversed) Intergenic
No off target data available for this crispr