ID: 1031925517

View in Genome Browser
Species Human (GRCh38)
Location 7:127634640-127634662
Sequence CTCAAGGTGAGGAGAAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031925513_1031925517 -7 Left 1031925513 7:127634624-127634646 CCTGAAAGTTCTAGGCCTCAAGG No data
Right 1031925517 7:127634640-127634662 CTCAAGGTGAGGAGAAGACCAGG No data
1031925510_1031925517 1 Left 1031925510 7:127634616-127634638 CCTCTTTCCCTGAAAGTTCTAGG No data
Right 1031925517 7:127634640-127634662 CTCAAGGTGAGGAGAAGACCAGG No data
1031925512_1031925517 -6 Left 1031925512 7:127634623-127634645 CCCTGAAAGTTCTAGGCCTCAAG No data
Right 1031925517 7:127634640-127634662 CTCAAGGTGAGGAGAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031925517 Original CRISPR CTCAAGGTGAGGAGAAGACC AGG Intergenic
No off target data available for this crispr