ID: 1031928521

View in Genome Browser
Species Human (GRCh38)
Location 7:127661459-127661481
Sequence GCCTAGGGATGAAGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031928521_1031928526 9 Left 1031928521 7:127661459-127661481 CCTGAGGAGCTTCATCCCTAGGC 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1031928526 7:127661491-127661513 CTCTCCTGTTTCTTATTCATAGG 0: 1
1: 0
2: 1
3: 31
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031928521 Original CRISPR GCCTAGGGATGAAGCTCCTC AGG (reversed) Intronic
910178083 1:84452667-84452689 GCCTATGGCAGAAGCTCCTACGG - Intergenic
912174707 1:107141294-107141316 GCCTGGGGAGGAGGCTCCGCGGG + Intronic
912307859 1:108589180-108589202 TCTCAGGGATGAACCTCCTCTGG + Intronic
913460511 1:119081070-119081092 TCCTAGAGCTGAAGCTCCCCAGG - Intronic
915238704 1:154503461-154503483 GCCTATGGTTGCAGCTACTCAGG + Intronic
916330837 1:163614732-163614754 GCCTGGCTCTGAAGCTCCTCTGG - Intergenic
916500613 1:165383878-165383900 GCTTTGGGATGAAACTGCTCTGG - Intergenic
917745005 1:177998121-177998143 GCCTATGGCTGACGCTCTTCTGG - Intergenic
921616654 1:217276278-217276300 CCCTAGAGATGAAGCTGCTAAGG + Intergenic
1062955743 10:1539169-1539191 GCCTTAGGATGTAGCTGCTCTGG + Intronic
1064818829 10:19300141-19300163 ACCTAGGGATGCAGCTCACCAGG + Intronic
1067574428 10:47400293-47400315 GCCTGAGGATCAAGCTCCACAGG - Intergenic
1069882601 10:71603097-71603119 GCCCAGGGATGAAGCTTCTCGGG - Intronic
1071861594 10:89679648-89679670 ACCTGGGGATGTAACTCCTCAGG - Intergenic
1073294437 10:102430481-102430503 TTCTAGGGAAGAAGCTTCTCAGG + Intronic
1074627985 10:115214932-115214954 GCCTAGGTATGTAGCACTTCTGG - Intronic
1080700679 11:34641465-34641487 GCCAAGGGCTGAAAATCCTCTGG + Intronic
1089849439 11:121483550-121483572 ACCAAAGGAGGAAGCTCCTCTGG + Intronic
1090860582 11:130648969-130648991 GCCTAGGAAGGAGGCCCCTCAGG - Intergenic
1090942557 11:131400367-131400389 GCATTTGGATGGAGCTCCTCTGG - Intronic
1091316674 11:134618781-134618803 GCCCAGGGCTGCAGCTCCTTTGG - Intergenic
1094535875 12:31323045-31323067 GGCTGGGGAGGAAGCTGCTCAGG - Intronic
1097343419 12:58465445-58465467 GCCAAGCAAAGAAGCTCCTCAGG + Intergenic
1097594613 12:61612976-61612998 GATTAGACATGAAGCTCCTCTGG - Intergenic
1100220102 12:92495780-92495802 GCCTAGAGTTCTAGCTCCTCAGG + Intergenic
1105443070 13:20431294-20431316 GCGTAGGGAGGACGCTGCTCGGG - Intronic
1107329773 13:39286501-39286523 GCCTATAGTTGAAGCTACTCTGG + Intergenic
1112894799 13:104285911-104285933 GCCCAGGGAGGTAGCTCCTTTGG - Intergenic
1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG + Intronic
1117249096 14:53917509-53917531 GCCAAGTGGTCAAGCTCCTCAGG + Intergenic
1118745576 14:68770673-68770695 GCCCAGGGCTGAAGCACCGCTGG - Intergenic
1120900743 14:89573659-89573681 GCCTGGGGATGAAGGGGCTCAGG - Intronic
1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG + Exonic
1123122860 14:105926213-105926235 GCACAGGGAAGAAACTCCTCCGG + Intronic
1126532524 15:49726753-49726775 GTCTAGTGCTGAAGTTCCTCAGG - Intergenic
1133747294 16:8696835-8696857 CCCTGTGGAGGAAGCTCCTCAGG + Intronic
1135571420 16:23552221-23552243 GCCTCAGGATGAAGCTCCCCTGG + Exonic
1137526904 16:49244500-49244522 CCTTAGGCATGAAGCTCCTCCGG - Intergenic
1139700803 16:68707024-68707046 GCCTAGGGAGGAAGGGCCTGGGG + Intronic
1146070010 17:29671730-29671752 GCCTTGGGGTGAAGCTTCTCAGG + Intronic
1147118745 17:38322437-38322459 AGCAAGGGATGAAGCTCTTCTGG + Intronic
1147695396 17:42348633-42348655 GACTAGGGATAAAGATGCTCTGG + Intronic
1153659990 18:7317771-7317793 GCCTAGGGATGCTGCTGCTGGGG - Intergenic
1155446228 18:25915652-25915674 GCCTGGTGATGAAGCTTCTTGGG + Intergenic
1159971012 18:74652693-74652715 ACCAAGGGAGGAAGCACCTCGGG - Intronic
1160439054 18:78875185-78875207 CCCTGGGGATGCAGCTCCACAGG - Intergenic
1163390725 19:17028238-17028260 CCCTAGGGATGTGGGTCCTCTGG + Intergenic
1165459397 19:35935725-35935747 GCCTTGGGAAGGAGCCCCTCTGG + Exonic
1166518749 19:43465427-43465449 TCTTAGGGAGGAGGCTCCTCTGG - Intronic
925183299 2:1830756-1830778 GCCCAGGGAAGAGGCTCCTGAGG - Intronic
926333816 2:11848614-11848636 GCCTTGGGTTCAAGTTCCTCGGG - Intergenic
926812690 2:16770593-16770615 GCCTGGGGAAGAGGCTGCTCAGG + Intergenic
927543509 2:23932632-23932654 GGCTAGGTATGAAGACCCTCAGG + Intronic
928933562 2:36650127-36650149 GCCTTGGCCTGAACCTCCTCTGG + Intergenic
930705571 2:54501777-54501799 GCCTGGGGATGGAGCCTCTCTGG + Intronic
931881789 2:66576731-66576753 GCCTTAGGCAGAAGCTCCTCAGG + Intergenic
932217818 2:69978205-69978227 CCCTGGGGAAGAAGCTTCTCTGG - Intergenic
933634648 2:84694139-84694161 GCCCAGGGAGGAGGCTCCACTGG + Intronic
940711100 2:157164641-157164663 GCCTATGGTGGAAGCTGCTCGGG - Intergenic
947098311 2:226591797-226591819 TCCCTGGGATGAAGCTCCTGGGG - Intergenic
948383309 2:237566566-237566588 GCCAAGGGATGAAGGTGCTGAGG + Exonic
1173419871 20:42891356-42891378 GCCCAGGGAAATAGCTCCTCTGG - Intronic
1175278392 20:57787358-57787380 GCCAAGGCATGCAGCTCCTCCGG + Intergenic
1176270237 20:64232443-64232465 GCCTGGGGCTGAAGCTCCTGAGG + Intronic
1179130926 21:38636545-38636567 GCCAAGGAATGAAGCACCTGTGG + Intronic
1180162486 21:46004396-46004418 GCCTAGGGAAGGAGCTGCGCAGG - Exonic
1181415013 22:22753118-22753140 GCCTGGGGCTGAAGCCACTCAGG - Intronic
1181712037 22:24696927-24696949 GCCTCGGCATGAAGGTCCTGGGG - Intergenic
1183232942 22:36594152-36594174 GCCTAGGAATGAAGCTAGTTGGG - Intronic
1183300772 22:37058063-37058085 GACTAGGGATAAAGTCCCTCGGG - Intronic
1185142044 22:49107999-49108021 CCATTGGGATGAAGCTCCCCTGG + Intergenic
952432345 3:33235892-33235914 GCCTAGGGATGAAGCTAGGCTGG + Intergenic
952441392 3:33333631-33333653 CCCTAGGTATGAAGCTGCTGTGG - Intronic
955932385 3:64070523-64070545 GCCTAGTAATGAATCCCCTCAGG + Intergenic
958731160 3:97962066-97962088 GACTAGTGAGGAAGCTTCTCAGG + Intronic
965447603 3:168794729-168794751 GCCTAGGGAGGAAGATGCTAAGG - Intergenic
968086310 3:195875497-195875519 GCCTTGGGATGAAGCTGCCTTGG - Intronic
968123752 3:196143840-196143862 GCATAGGGATGGACCTCCTGGGG + Intergenic
968437194 4:599868-599890 TCCTTGGGATGGAGCTCCTGTGG - Intergenic
968703354 4:2066978-2067000 GCTGAGGGCTGAAGCGCCTCGGG + Exonic
969603054 4:8188485-8188507 GCCTAGGTTTGAAGCACCTTGGG - Intronic
973610111 4:52628198-52628220 GCCTGGGGATGAGCCACCTCTGG + Intronic
974969121 4:68803386-68803408 CCCAAAGGATGAAGGTCCTCTGG + Intergenic
980357435 4:131738331-131738353 GCCTAGGAAAGAGGCTGCTCCGG - Intergenic
981093679 4:140757333-140757355 GTCTAGGGATAAAGCTGCCCTGG - Intergenic
986338851 5:6773797-6773819 GCAGAGCGATGAAGCCCCTCTGG - Intergenic
994129342 5:96207021-96207043 ACCTAGGAATGAAGCTCACCAGG - Intergenic
998557294 5:143137932-143137954 TCCCAGAGAAGAAGCTCCTCAGG + Intronic
1001177706 5:169487157-169487179 GCCATGGGATGAGGCTCCTCAGG + Intergenic
1001433697 5:171683161-171683183 CCCTAGGGAGGTAGCACCTCAGG + Intergenic
1001672087 5:173481973-173481995 GCCTAGGAATGCAGCTCTTCTGG + Intergenic
1001788250 5:174432331-174432353 CCCTAGGGTTGCATCTCCTCAGG - Intergenic
1006409283 6:33862997-33863019 TCCTAGGGAAGAGGCCCCTCAGG + Intergenic
1007421625 6:41723299-41723321 GGGTAGGGATGAGGCCCCTCAGG - Intronic
1010009743 6:71036372-71036394 GTTGAGGGAGGAAGCTCCTCAGG - Intergenic
1011165235 6:84439240-84439262 GCCTAGGGATGAAGTTACTCTGG - Intergenic
1012528511 6:100206031-100206053 ACCTAGGTATTAAGCCCCTCAGG + Intergenic
1015973090 6:138762369-138762391 GCCTAAGGATGAAGCTAAACTGG - Intronic
1019470084 7:1214840-1214862 GGCTTGGGATGAAGCCCATCAGG + Intergenic
1020515055 7:9107252-9107274 GCCATTGGATGAGGCTCCTCTGG + Intergenic
1022504613 7:30902541-30902563 CCCTGGGGCTGCAGCTCCTCAGG - Intergenic
1024042228 7:45564653-45564675 TCCTCAGGCTGAAGCTCCTCCGG + Intergenic
1029290605 7:99499723-99499745 ACCCAGGCTTGAAGCTCCTCGGG + Exonic
1031928521 7:127661459-127661481 GCCTAGGGATGAAGCTCCTCAGG - Intronic
1037948357 8:23003507-23003529 TCCTAGGGAGGATGATCCTCAGG - Intronic
1056968764 9:91185674-91185696 GCCCAGAGATGAGGCCCCTCAGG + Intergenic
1057412071 9:94825546-94825568 GCCTAGGGAGGGCGCTCCCCTGG - Intronic
1061724738 9:132575902-132575924 GCCTAGGGAGGCAGCTGGTCTGG + Intergenic
1061754294 9:132802154-132802176 GCCTGGGGATCCAGCTCCTGAGG + Intronic
1191059284 X:56277904-56277926 GCCAAGGGGTGAGGCTCCTCTGG - Intronic
1192057685 X:67788751-67788773 GCCTAGGGCCGAATTTCCTCAGG - Intergenic
1193258780 X:79380556-79380578 TCCCAGGGATGAAGCTCCTGGGG + Intergenic
1193378608 X:80791713-80791735 GACTAGCCATGAAACTCCTCAGG + Intronic
1194580631 X:95666333-95666355 CCCTTGGGATGAAGCCCATCAGG + Intergenic
1196440282 X:115713532-115713554 GCCTAAGGCTGAAGCTGGTCTGG + Intergenic
1201313203 Y:12616300-12616322 GCCTTGTGATTGAGCTCCTCTGG - Intergenic