ID: 1031932603

View in Genome Browser
Species Human (GRCh38)
Location 7:127701315-127701337
Sequence CTGTTAATGGTGAGGCTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031932595_1031932603 11 Left 1031932595 7:127701281-127701303 CCAAGGCACTTTGTGGACTCACA 0: 1
1: 0
2: 3
3: 14
4: 154
Right 1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 185
1031932592_1031932603 22 Left 1031932592 7:127701270-127701292 CCATTGAAAACCCAAGGCACTTT 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 185
1031932594_1031932603 12 Left 1031932594 7:127701280-127701302 CCCAAGGCACTTTGTGGACTCAC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031932603 Original CRISPR CTGTTAATGGTGAGGCTGGT GGG Exonic
900739418 1:4321666-4321688 CTGTTTAGGGTGGGGCTAGTTGG + Intergenic
902542710 1:17166118-17166140 ATGTTGATGGTAAGGATGGTGGG - Intergenic
902633398 1:17719325-17719347 CTGCTGGTGGTGTGGCTGGTTGG + Intergenic
902866300 1:19282199-19282221 ATGTTAGAGGTGAGCCTGGTGGG + Intergenic
903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG + Intronic
904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG + Intergenic
911080596 1:93925779-93925801 CTGATAATTGGGTGGCTGGTGGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919976229 1:202614833-202614855 CGGTTCAGGGTGAGGCTGGCAGG + Intronic
924112990 1:240718120-240718142 CAGCTACTGGGGAGGCTGGTAGG - Intergenic
1062922225 10:1289029-1289051 TTGTTGATGTTAAGGCTGGTTGG - Intronic
1063858795 10:10285716-10285738 GTGTTTGTGGTGATGCTGGTGGG + Intergenic
1064837902 10:19555259-19555281 ATGTTAAAGGTGAGCCTGGTAGG - Intronic
1068632094 10:59308590-59308612 GTGGTGATGGTGATGCTGGTTGG - Intronic
1069296833 10:66856547-66856569 CAGTTACTGGTGAGGCTGTAGGG - Intronic
1069511325 10:69044605-69044627 CTTTTATTGGTGGGGCTGTTAGG + Intergenic
1069543213 10:69311191-69311213 CTGTTGATGTTAATGCTGGTCGG + Intronic
1069850624 10:71402073-71402095 CTGTCAATGGTGAGTGGGGTGGG + Intronic
1070372016 10:75791700-75791722 CTGGTAATGGAGAGGCCGGAAGG - Intronic
1071547507 10:86539619-86539641 CAGTTGCTGGTGAGGCTGGGAGG - Intergenic
1072284884 10:93904892-93904914 CGGTTCCTGGTGAGGCTGCTCGG - Intronic
1072588151 10:96800566-96800588 GTGTTAATGTTAATGCTGGTTGG - Intergenic
1073323564 10:102629840-102629862 CTGTCAATAATGAGGCAGGTTGG - Intronic
1073895981 10:108158444-108158466 CTGGTAATGGAGAGGCTGCTTGG - Intergenic
1074141121 10:110673577-110673599 CTGGTGCTGGTGAGGCTGGCCGG - Intronic
1076005819 10:126947668-126947690 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076005910 10:126948172-126948194 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076205873 10:128602254-128602276 CTGTGGATGGTGAGGCTGTTGGG - Intergenic
1076564306 10:131387579-131387601 CTGTTAATGGTGGGGGAGGCTGG - Intergenic
1076619956 10:131780695-131780717 ATGTTAATGGCGAGGCTGTTTGG - Intergenic
1077753067 11:4994827-4994849 CTGTGAGTGGTGAGGCTTGAAGG - Intergenic
1080174430 11:29344702-29344724 ATGTTGAAGGTGGGGCTGGTGGG + Intergenic
1082114530 11:48313960-48313982 CTGTTGGGGGTGGGGCTGGTGGG + Intergenic
1087529839 11:99366053-99366075 CTGTTAGTGATGAGGATGGATGG - Intronic
1088500675 11:110479407-110479429 CTATTGATGGTGGTGCTGGTGGG + Intergenic
1089335513 11:117720336-117720358 CTGCTAATTCTGAGGCTGGGAGG - Intronic
1090130545 11:124137007-124137029 CGGTGAATGGTGAGGCTGAAAGG - Exonic
1090836424 11:130457590-130457612 CTGGGAATCGTGAGGCAGGTAGG + Intronic
1093131167 12:15393046-15393068 CAGTTAATGGTTTGGCTAGTTGG - Intronic
1093218724 12:16393239-16393261 CTGTGAATGGTGACAGTGGTAGG + Intronic
1094670794 12:32566849-32566871 TTGTGAATGGTGAGGTTGCTGGG + Intronic
1095454652 12:42370272-42370294 CTGCAAATGCTGAGGCAGGTAGG + Intronic
1098903088 12:76132867-76132889 ATGTTGGAGGTGAGGCTGGTGGG - Intergenic
1100756243 12:97753772-97753794 CTGTTAATGGTGAATCAGGGTGG - Intergenic
1102084770 12:110126790-110126812 CTGTTATTGGTGTGGCCGGTAGG - Intronic
1103158577 12:118708227-118708249 ATGGTAATGGTGATGGTGGTAGG + Intergenic
1103935615 12:124474964-124474986 CTGTGAATCCTGAGGTTGGTGGG - Intronic
1104743993 12:131199271-131199293 ATGATGATGGTGAGGATGGTGGG - Intergenic
1106542958 13:30706276-30706298 TTGATAATGGTGGTGCTGGTTGG - Intergenic
1106666313 13:31854484-31854506 CGCATAATGGTGAGGCTGGTGGG + Intergenic
1108969609 13:56356750-56356772 TTGTTAATGGTGATGATAGTGGG - Intergenic
1112216584 13:97436451-97436473 ATGTGAAGGGTGAGGCTGTTGGG - Intronic
1113863934 13:113509048-113509070 CTGTGTATGTTGGGGCTGGTGGG + Intronic
1113863949 13:113509098-113509120 CTGTGTATGTTGGGGCTGGTGGG + Intronic
1114477675 14:23008863-23008885 CTGTTCATGGTGATGGTGATGGG - Intronic
1115133283 14:30078710-30078732 CTGATATTGGTTAGCCTGGTGGG + Intronic
1120643046 14:87038508-87038530 CTGCAAATGGTGAGGCTTCTTGG + Intergenic
1121613025 14:95294089-95294111 CTGTTTAGGGTGAGGTAGGTAGG - Intronic
1122453252 14:101829084-101829106 CTTTTATTGCTGAGTCTGGTTGG + Intronic
1123479097 15:20614723-20614745 GTGTTCATGTAGAGGCTGGTGGG - Intergenic
1123638915 15:22385662-22385684 GTGTTCATGTAGAGGCTGGTGGG + Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1124574338 15:30894798-30894820 ATGTTAATGGTGATGCAGGCTGG - Intergenic
1124695240 15:31858724-31858746 CAGTGAATGGTGGGGCTGGCCGG - Intronic
1127233661 15:57023827-57023849 CTGTGGATGGTGAGGGTTGTAGG + Intronic
1128620245 15:69142868-69142890 CTGTTAATTGTGCTACTGGTTGG + Intergenic
1129052635 15:72795467-72795489 CTGTTAATGGTAGTGGTGGTGGG - Intergenic
1129361531 15:75027657-75027679 CTGTTAGTGGAGAGACTGGAGGG - Intronic
1129790000 15:78334687-78334709 CCGTTCCTGGTGAGGCAGGTGGG + Intergenic
1130054662 15:80512167-80512189 CTGTTTATGTACAGGCTGGTTGG + Intronic
1131662294 15:94530928-94530950 CTGTTTATGGAGCAGCTGGTAGG + Intergenic
1131786476 15:95917801-95917823 ATGTTTATGGTAAGGCTGTTGGG + Intergenic
1132743519 16:1427510-1427532 CGGTTTCTGGTGAGGCTGGGTGG - Intergenic
1137779117 16:51082248-51082270 CTGGTTATGGTTAGTCTGGTAGG + Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1140107885 16:71977409-71977431 GTGCTCATGTTGAGGCTGGTGGG + Exonic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143635540 17:8162283-8162305 CTGTTACTGGTGAGGTTTGGAGG + Exonic
1146466989 17:33094188-33094210 CAGTTAATGGTGGGCCAGGTAGG + Intronic
1147258260 17:39194864-39194886 CAGGTAATGGGGAGGCTGGGCGG - Exonic
1149397586 17:56260723-56260745 CTGTGCCTGGTGAGGCTGGCAGG - Intronic
1150469747 17:65426805-65426827 ATGTTAGGGGTGAGCCTGGTGGG + Intergenic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1152845694 17:82598431-82598453 CTGGTGAGGGTGAGGCTGTTGGG + Intronic
1153232742 18:2955518-2955540 GTGTTAGAGGTGAGCCTGGTGGG - Intronic
1154144834 18:11858888-11858910 CTGACAGTGATGAGGCTGGTGGG - Intronic
1155076219 18:22357957-22357979 CAGTTACTCGGGAGGCTGGTAGG - Intergenic
1157540431 18:48499220-48499242 CTGTTAATGGTGAGGTTAGATGG - Intergenic
1158884538 18:61814314-61814336 CTGAAAATGGTGAGGAGGGTGGG - Exonic
1160006577 18:75073083-75073105 CTGGATATGGGGAGGCTGGTGGG + Intergenic
1161373402 19:3926489-3926511 CAGTTAATTGTGGGTCTGGTTGG - Exonic
1161597123 19:5156269-5156291 CCGTGAATGGTGGGGTTGGTGGG - Intergenic
1162918759 19:13888349-13888371 CTGCTAGAGGTGAGGCAGGTGGG - Intronic
1163651451 19:18520714-18520736 CTGTTGATGGTGGGGGTGGGGGG - Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1165819636 19:38666284-38666306 CTGTTAGGGGAGAGGCTGGGAGG - Intronic
1167081587 19:47279795-47279817 CTGGTGAGGGTGAGGCTGGCAGG + Intergenic
925745169 2:7037979-7038001 CTGTGAATGGCGAGGCCGGCTGG + Intronic
926077027 2:9950662-9950684 AAGTAAATGGTGTGGCTGGTTGG - Intergenic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
931690921 2:64834314-64834336 CTTTTGCTGGTGAGGCTGCTGGG - Intergenic
932232577 2:70094848-70094870 CTTGCACTGGTGAGGCTGGTGGG - Intergenic
934107721 2:88711030-88711052 CTGTTGATGGTGAAGCTCTTTGG + Intronic
934585249 2:95486909-95486931 ATGTTGATGGCCAGGCTGGTTGG + Intergenic
934788568 2:97035835-97035857 ATGTTGATGGCCAGGCTGGTTGG + Intergenic
934936341 2:98468620-98468642 CTGTTTAGTGTGTGGCTGGTGGG + Intronic
935332579 2:101987935-101987957 CTCTTCCTGCTGAGGCTGGTGGG + Intergenic
937117646 2:119420105-119420127 GTGTTGAAGGTGGGGCTGGTGGG - Intergenic
938830298 2:135043534-135043556 CTGTTGATGGCGAGGCCAGTAGG - Intronic
943597155 2:189872075-189872097 CTGTTAAAGGTGGGCCTAGTGGG - Intronic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
945000391 2:205344100-205344122 CTTTTAATGGTGTTGCTGCTGGG + Intronic
946300244 2:218819343-218819365 CTGTTCATGGTGATGCTTGGGGG - Intergenic
948899798 2:240950508-240950530 CAGGTGATGGTGAGGCTGGGGGG + Intronic
1169640692 20:7747532-7747554 TTGTTGAAGATGAGGCTGGTGGG + Intergenic
1173417887 20:42874114-42874136 CTGATCATGGTGATGCTGGCTGG - Intronic
1173866828 20:46317730-46317752 CTCTGCAAGGTGAGGCTGGTGGG - Intergenic
1175987938 20:62773370-62773392 CTGCAAATGCTCAGGCTGGTGGG - Intergenic
1180614523 22:17119194-17119216 CAGTTAACGGTGAGGGAGGTAGG - Exonic
1182884664 22:33763073-33763095 CTGGAAATGCTAAGGCTGGTGGG - Intronic
1183695269 22:39418163-39418185 CTGTTCATGGGGATACTGGTTGG - Intronic
1185088165 22:48751975-48751997 CTGTGGCTGGTGAGGCTGGTGGG + Intronic
952139918 3:30466744-30466766 CTGTTGATGGTCAGGTTTGTGGG + Intergenic
952773465 3:37022601-37022623 CTGGAAATGGTTTGGCTGGTGGG + Intronic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
954538291 3:51377533-51377555 TTGTTAATGGTGAGGGAGGGAGG + Intronic
954923496 3:54212572-54212594 CTGTTGATGTTAATGCTGGTTGG + Intronic
959358443 3:105361168-105361190 CTGTTAGAGGTGGGGCTGTTTGG - Intergenic
960169530 3:114442460-114442482 CTGTTACTGGTGTTCCTGGTGGG - Intronic
961458981 3:127038339-127038361 GAGTTCATGGAGAGGCTGGTGGG - Intergenic
962787707 3:138783714-138783736 ATGGTACTGGGGAGGCTGGTAGG + Intronic
963289304 3:143471191-143471213 CTGAGAATGGTGAGGCTGCCGGG + Intronic
964495356 3:157283543-157283565 GTGTTGATGGTGAAGTTGGTGGG + Intronic
964561769 3:158004823-158004845 CTGTTAGTGGGTAGGCGGGTAGG + Intergenic
974129886 4:57741386-57741408 GTGATAGTGGTGAGGCAGGTAGG - Intergenic
975245109 4:72111527-72111549 CTGTTAATGGGGAAGCTAATGGG + Intronic
982598199 4:157412718-157412740 CTGTTGGGGGTGGGGCTGGTGGG - Intergenic
983905882 4:173182784-173182806 CTCTGAATGATGAGGCTAGTAGG + Intronic
983905893 4:173182998-173183020 CTTTGAATGGTGAGGCTAGCAGG + Intronic
985357083 4:189132900-189132922 ATGTTAGAGGTGGGGCTGGTGGG + Intergenic
986367987 5:7054429-7054451 CTGTTAATGGTGCAGATGGCTGG + Intergenic
986737761 5:10680851-10680873 TTGTTTATGGGGAGTCTGGTTGG - Exonic
990358138 5:54990601-54990623 ATGTTAATGAGGAGGCTGGTTGG - Intronic
991618571 5:68521323-68521345 TTGTTAATAGTGATGGTGGTGGG - Intergenic
993956091 5:94234794-94234816 ATGTTGGAGGTGAGGCTGGTGGG - Intronic
994344131 5:98664705-98664727 CTGGTAATGGGGAGACTGGGTGG + Intergenic
995459360 5:112386925-112386947 CTGTCAGTGGTGAGGTCGGTGGG - Intronic
995815363 5:116161539-116161561 CTGTTATTGGTAAGGCTTCTGGG - Intronic
996551847 5:124739116-124739138 ATGTTAATGGTGAAGCTGCGGGG - Intronic
997239472 5:132295802-132295824 CTGCTATTGGTCAGGCAGGTAGG + Intronic
1000357823 5:160417902-160417924 GTTGTAATGGTGAGGCTGGAAGG - Intronic
1004170826 6:13294384-13294406 CTGTTAGTGGTGCTGTTGGTAGG - Intronic
1004292417 6:14380452-14380474 CTGTTACTGGAGAGGCAGATAGG - Intergenic
1007191921 6:40026676-40026698 CTGTAAAGGGTGATTCTGGTGGG + Intergenic
1007387096 6:41527662-41527684 ATGTCAATGATGAGGCAGGTTGG + Intergenic
1008067156 6:47061872-47061894 CTGTAAATGGGGAGGGTGCTGGG + Intergenic
1012160606 6:95880570-95880592 GTGGTAATGGTGGGGGTGGTAGG - Intergenic
1012873655 6:104700161-104700183 CTGTCACTGGTGTAGCTGGTGGG + Intergenic
1013183513 6:107737740-107737762 CTTGTAATGGTGAGCCGGGTGGG + Intronic
1014219731 6:118787902-118787924 ATGTTAATGGTGATGTTGGCTGG + Intergenic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1017042761 6:150320885-150320907 CTGTTAATTCTGAAGTTGGTTGG - Intergenic
1017905298 6:158753940-158753962 CTATTAAGGATGAGGCTGGCCGG - Intronic
1019667239 7:2257959-2257981 CTGGTAATGGGTGGGCTGGTGGG - Intronic
1024326809 7:48115242-48115264 GTGTTAAAGGTGGGCCTGGTGGG - Intergenic
1026001153 7:66559380-66559402 CTGGTCATGGTGAGACTGCTAGG - Intergenic
1027178379 7:75919698-75919720 CTGTTACTCCTGACGCTGGTCGG + Intronic
1030005247 7:105112186-105112208 CTGTGAATGATGAGGCCTGTAGG - Exonic
1031555585 7:123171783-123171805 CTGAAAATGGTGATGATGGTTGG - Exonic
1031613882 7:123857792-123857814 CTGGTAATGATCAGGCTGATTGG + Intronic
1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG + Exonic
1033206971 7:139431491-139431513 CTGGTAATTCTGATGCTGGTTGG - Intergenic
1035200945 7:157265607-157265629 CTATTAATGGTGAGGCTATATGG - Intronic
1038199774 8:25401175-25401197 ATGGAAATAGTGAGGCTGGTGGG + Intronic
1040419093 8:47222388-47222410 CTGGTAATGGTGATGATGCTGGG - Intergenic
1040779476 8:51091173-51091195 GTGTTAATGTTAATGCTGGTCGG + Intergenic
1054775456 9:69120852-69120874 CGGCTAAGGGTGAGGCTGGCGGG + Intergenic
1056464808 9:86843161-86843183 CAGTTGATGGTGAGACTGGATGG - Intergenic
1059520218 9:114933797-114933819 CTGGAGATGGTGAGGCGGGTTGG - Intergenic
1185672471 X:1824056-1824078 GTATTAGTGGTGAGGCTGGATGG - Intergenic
1185672820 X:1825735-1825757 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1185673021 X:1826660-1826682 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1186873307 X:13793081-13793103 CTGTTGATGTTAATGCTGGTTGG - Intronic
1188529382 X:31122421-31122443 GTGATAATGGTGACGATGGTTGG - Intronic
1188661268 X:32761795-32761817 CTGTTAATGGAAAGTCTGGAAGG - Intronic
1189391463 X:40580549-40580571 CTGTGAAAGGCGGGGCTGGTTGG - Intergenic
1189895522 X:45651613-45651635 ATGTTAATGGTGATTCAGGTAGG - Intergenic
1190185323 X:48228626-48228648 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190190722 X:48274694-48274716 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190664860 X:52687299-52687321 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190674562 X:52771120-52771142 ATGGTGATGGTGAGGCTGGAAGG - Intronic
1192557446 X:72101701-72101723 CTGGTAATGGGGAAGCTGGCAGG - Intergenic
1194323510 X:92481167-92481189 CTGGTAAAGGTGGGGCTGCTGGG + Intronic
1197108278 X:122742199-122742221 CAGTTAGTGGTGGGGCTGCTGGG - Intergenic
1200234672 X:154462491-154462513 CTGGCAATGGTGAGGGTGGGCGG - Intronic
1200254536 X:154572948-154572970 CTGTTTCTGGTGATGCTGGGTGG + Intergenic
1200263233 X:154631460-154631482 CTGTTTCTGGTGATGCTGGGTGG - Intergenic