ID: 1031934443

View in Genome Browser
Species Human (GRCh38)
Location 7:127721717-127721739
Sequence CTGTGAATAAGGAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 523}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031934443 Original CRISPR CTGTGAATAAGGAGAGGAGA AGG Intronic
901266390 1:7914079-7914101 CTGGGATTGAGGAGAGGGGAAGG - Intergenic
901658606 1:10784950-10784972 CCGTGAAGGAGCAGAGGAGAGGG - Intronic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
901879673 1:12186321-12186343 CTGTGAGGAAGGGGAGGAGGAGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904698538 1:32344523-32344545 CTCTGAACAAGCAGAAGAGAAGG - Intergenic
905188868 1:36217396-36217418 GGCTGAATGAGGAGAGGAGAGGG + Intergenic
905400218 1:37696338-37696360 CTGGGAGGAAGGAGATGAGAGGG - Intronic
905637247 1:39562508-39562530 ATGTGAAAGAGGAGAGGAGGTGG + Intronic
905969881 1:42133689-42133711 TTGTGCATATGGAGAGGAAAGGG + Intergenic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906304605 1:44708837-44708859 CAGAGAATAAGCAGAAGAGAGGG - Intronic
906700626 1:47855316-47855338 CTGGGATTAAGGAGAGGAAAGGG - Intronic
906819485 1:48914127-48914149 CTGTGGAGAACGAGAAGAGAAGG + Intronic
907872670 1:58457101-58457123 CTGTGCAAAATGAGAGGAGATGG - Intronic
908175646 1:61552754-61552776 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
908411066 1:63866034-63866056 CCTTGAATAAGGAGTAGAGAGGG + Intronic
908669616 1:66532704-66532726 CAGAGAAAAAGGAAAGGAGATGG - Intergenic
908906437 1:69017295-69017317 TTGGGAATAAGGAGAAGAGAAGG - Intergenic
910937365 1:92495303-92495325 TTGTGATTAAGGAGAGAAGTGGG - Intergenic
910991493 1:93061278-93061300 CAGTGAATAAGGAGAAGGCAGGG - Intergenic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
914224295 1:145707592-145707614 CAGAGAACAAGGAGGGGAGAGGG + Intronic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915592585 1:156879099-156879121 CTGTGAACAAGAAAAGGAGAGGG - Intronic
916325603 1:163556411-163556433 CTGTGATTAAGGGAAGGAGCAGG - Intergenic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
916746081 1:167685863-167685885 CTTGGAATAAGGTGTGGAGAAGG + Intronic
917032503 1:170709249-170709271 CTGAGACTTAGGAAAGGAGAAGG + Intronic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
917811574 1:178663423-178663445 ATGTGAAGAATGAGTGGAGAAGG + Intergenic
918157303 1:181861106-181861128 TTGTGAATAAGAAAAGGGGAAGG + Intergenic
919475288 1:198025295-198025317 ATGTGAATAAAAAGGGGAGAGGG + Intergenic
919756288 1:201068071-201068093 CTGTGGATAAGGTGTGGAAAAGG + Intronic
919966385 1:202530749-202530771 CTGGGAGTAGGGAGAAGAGATGG - Intronic
919969298 1:202563009-202563031 CTCTGAATAAGCAGAAGAAAAGG + Intronic
920420510 1:205830111-205830133 CTGGCAATAAGGACAGTAGATGG + Intronic
921040138 1:211423305-211423327 GTGTGAATAAGTATAGGAAAAGG + Intergenic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922974876 1:229776013-229776035 CTTAGAATAAGGAAAGGAGTTGG + Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
923773564 1:236958829-236958851 CTGAGAATAAGCTGTGGAGAAGG + Intergenic
924907251 1:248469472-248469494 CTCTGCTTTAGGAGAGGAGAGGG - Intergenic
924916859 1:248578641-248578663 CTCTGCTTTAGGAGAGGAGAGGG + Intergenic
1063495967 10:6508645-6508667 TTGTGAATAAGGAGTAAAGATGG + Intronic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1064129096 10:12691790-12691812 CTGTGAATAAAGTGAAGAGGAGG + Intronic
1065446192 10:25803697-25803719 CTGAGAAACAGGAGAGCAGAAGG + Intergenic
1065988774 10:30985679-30985701 CTGTGAATAAGGAGAACCAACGG - Intronic
1067536180 10:47111886-47111908 GTGTGAATGAGGAGAAGAAAAGG + Intergenic
1067850373 10:49750512-49750534 CTGTGGACAAGGAGAGGTGGAGG - Intronic
1067894075 10:50161013-50161035 GTGGGAGTAAGAAGAGGAGATGG - Intergenic
1067954772 10:50779251-50779273 GTGGGAGTAAGAAGAGGAGATGG + Intronic
1068255208 10:54500492-54500514 CTGTCACTTAGGAGAGGACAGGG + Intronic
1068571066 10:58629974-58629996 GCATGAAAAAGGAGAGGAGAAGG + Intronic
1068602421 10:58969709-58969731 CTGAGAAGAGGGACAGGAGAGGG + Intergenic
1070277567 10:75022063-75022085 CAGTGAAGAAGAAGAGGAGGAGG + Exonic
1070442399 10:76459608-76459630 GTGGGAATAGGGAGAGGAAATGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071293873 10:84205413-84205435 GAGGGAATAAAGAGAGGAGAGGG - Intronic
1071531626 10:86393816-86393838 CTGTGAATAATCAGAAGAGTTGG - Intergenic
1072738598 10:97896132-97896154 CTGTTAGGAAGGATAGGAGATGG - Intronic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073890028 10:108090764-108090786 CTCTGCTTAAGGAAAGGAGAAGG + Intergenic
1074522008 10:114234485-114234507 CTGGGAATTTGGAGAGGAGATGG + Intergenic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075051283 10:119184064-119184086 GTGGGCATAAGGAGAAGAGAAGG - Intergenic
1075567635 10:123516064-123516086 CTATGAAGAAGGAGAGGACATGG - Intergenic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1076393654 10:130122266-130122288 CTGTCCACAGGGAGAGGAGAGGG - Intergenic
1076671914 10:132126178-132126200 CTGGGAATTAGGACAGGAGGTGG - Intronic
1077427389 11:2489621-2489643 CTCTGCTTAAAGAGAGGAGATGG + Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077670911 11:4156827-4156849 TTGGGAATGAGGAGAGGAGAGGG - Intergenic
1077862795 11:6198390-6198412 CCGTGAAGAAGGAAAGGAAACGG + Intergenic
1078462996 11:11529486-11529508 CCGAGAATAAGGAGAGCAGATGG - Intronic
1079101844 11:17546955-17546977 CTCTGTAAAAGGAGAGGATAGGG + Intergenic
1079801929 11:24879854-24879876 TTCTGTATGAGGAGAGGAGAGGG - Intronic
1080224297 11:29943389-29943411 AGGTGGATGAGGAGAGGAGAAGG - Intergenic
1081073768 11:38642758-38642780 CTCTGTTTAAGGAGACGAGAAGG - Intergenic
1081319567 11:41674865-41674887 TGGCGAATAAGGAAAGGAGAAGG - Intergenic
1083832743 11:65243330-65243352 CTGGGATTACAGAGAGGAGAAGG + Intergenic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1085118218 11:73949249-73949271 AGGTGAATGAGGAGAGGGGATGG + Intergenic
1085167879 11:74419858-74419880 CTTTGAATGAAGAGAGGATAAGG - Intergenic
1086186738 11:84026688-84026710 CTGGGAATATGGAGTGGGGAAGG - Intronic
1086273394 11:85095593-85095615 CTGTGAAGAGGGATAGGAGCTGG - Intronic
1086306423 11:85485562-85485584 ATGTGAGTAAGGAGAGGGAAGGG + Intronic
1086898692 11:92341854-92341876 ATGAGTATCAGGAGAGGAGAAGG - Intergenic
1087676594 11:101169601-101169623 ATGTGTATAGGGTGAGGAGAAGG + Intergenic
1087712988 11:101575900-101575922 CTATGAAAAGGGAGAAGAGAAGG + Intronic
1088335957 11:108704117-108704139 CTGGGAATGAGTAGATGAGATGG + Intronic
1088375846 11:109140879-109140901 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1088411462 11:109539318-109539340 TTCTGCATAAGGAAAGGAGAGGG - Intergenic
1088728376 11:112659039-112659061 CTGTGAAGAAGAGGAGGTGAGGG - Intergenic
1089570939 11:119409110-119409132 GTGGGAATATGGAGAGGAGGCGG - Intergenic
1089849044 11:121481200-121481222 CTGTGCACTAGGAGAGGAGCTGG - Intronic
1089849088 11:121481416-121481438 CTGTGCACTAGGAGAGGAGCTGG - Intronic
1089943024 11:122439489-122439511 TTTTGAAGAAGGAGAGGAAAGGG + Intergenic
1090434359 11:126674547-126674569 CTTGGAATTAGGAAAGGAGATGG - Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091201098 11:133781871-133781893 CTGAGAATAAGGTGAGGAGGAGG - Intergenic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1092246421 12:6866847-6866869 GTGTGAATAAAGAGAGGGAAGGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092838667 12:12517075-12517097 CTGTGAATAAGGAGAACAAGAGG - Intronic
1094257552 12:28450091-28450113 CTGTCAACAAGGAGAGTAGCTGG - Intronic
1095227463 12:39694845-39694867 CTCTGCTTGAGGAGAGGAGAAGG + Intronic
1095405563 12:41863410-41863432 CTGAGAAGAAAGAGAAGAGAAGG + Intergenic
1095575670 12:43735558-43735580 CTTAAAATATGGAGAGGAGAAGG - Intronic
1095820901 12:46477514-46477536 CTGTGAATGAAGAGAGGGTAGGG - Intergenic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1098736680 12:74113428-74113450 CTTTGCTTGAGGAGAGGAGATGG - Intergenic
1100572324 12:95854414-95854436 CTGTGCTTCAGGAGAGGAGGAGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102427555 12:112856091-112856113 CTCTGAATCAGCAGAGGAAATGG - Intronic
1102760348 12:115379782-115379804 CAGTGAATAGGGAGAAGAGCCGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1106160184 13:27194513-27194535 CTTGGAAAAAGGAGATGAGATGG - Intergenic
1107466809 13:40658599-40658621 TTATGAATGAGGATAGGAGAAGG + Intronic
1108165774 13:47691833-47691855 GTGTGAAGATGGAGAAGAGAGGG - Intergenic
1108543538 13:51467573-51467595 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1108941283 13:55957551-55957573 CTGAGAATTAGGAGAGCAAATGG + Intergenic
1108959884 13:56213489-56213511 CTGAGAAAAAGGAGAGTTGATGG - Intergenic
1109491715 13:63109653-63109675 TTGTGAAAAAGGAGAGGAAGAGG + Intergenic
1109921873 13:69074577-69074599 CGTTGAATAAGTTGAGGAGAAGG + Intergenic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110670999 13:78177691-78177713 GTGAAAATAAGGGGAGGAGAAGG - Intergenic
1113521977 13:110947744-110947766 GTGTGAACAGGGAGTGGAGAAGG + Intergenic
1113705915 13:112432952-112432974 GTGTGAACAGGGAGTGGAGAAGG - Intronic
1113840198 13:113354894-113354916 CTGAGAAAAATCAGAGGAGAAGG + Intronic
1114570660 14:23665227-23665249 CTGGGAATAGGGGGAGAAGAAGG - Intergenic
1115738004 14:36355750-36355772 CACTGATTAAAGAGAGGAGAAGG - Intergenic
1116057820 14:39885627-39885649 CTGTGCTTGAGGAGAAGAGAGGG + Intergenic
1116079354 14:40153991-40154013 CTTTGCTTGAGGAGAGGAGAGGG + Intergenic
1116542302 14:46113100-46113122 CTGTGAAAAAAGCCAGGAGAGGG + Intergenic
1117053570 14:51887163-51887185 CTCTGAATAAGGAAAGCATAGGG - Intronic
1119401846 14:74368054-74368076 CAGTGAATGAGCAGAGAAGATGG + Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1122704189 14:103609751-103609773 CTGGAAATGAGGAGAGGGGAGGG + Intronic
1123683523 15:22781243-22781265 CTGTCAAGCAGGAGAGGAGATGG + Intronic
1124335731 15:28855644-28855666 CTGCCAAACAGGAGAGGAGATGG + Intergenic
1124346386 15:28924167-28924189 TTGAGAACAAGGAGGGGAGAGGG - Intronic
1126167604 15:45666929-45666951 ATGGGAGAAAGGAGAGGAGAGGG - Intronic
1126353232 15:47767159-47767181 CTGCGCAAAAGGAGGGGAGAAGG - Intronic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127830958 15:62750809-62750831 TTGTGAAAAAAGAGAGGAAATGG - Intronic
1128721731 15:69955297-69955319 GTGGGAGTAGGGAGAGGAGAAGG - Intergenic
1129057818 15:72834428-72834450 CTGAGAATGAGAAGTGGAGAAGG + Intergenic
1129113259 15:73350670-73350692 CTGTGACTGGGAAGAGGAGATGG - Intronic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1130367659 15:83254676-83254698 CTGTGAATATGGAGAGTTGGTGG + Intergenic
1130923691 15:88369371-88369393 ATGTTAATCAGGAGAGGGGAGGG - Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1133447496 16:5874646-5874668 CTGAGAATAAGGAGAGCAGCTGG + Intergenic
1134060835 16:11198578-11198600 AGGGGAAAAAGGAGAGGAGAGGG + Intergenic
1134166431 16:11933717-11933739 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134494282 16:14720012-14720034 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134499663 16:14759132-14759154 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134526211 16:14945759-14945781 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134546197 16:15110614-15110636 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134580913 16:15369912-15369934 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134713789 16:16344230-16344252 GTGAGAGTGAGGAGAGGAGAAGG - Intergenic
1134721659 16:16387584-16387606 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134888730 16:17819291-17819313 CTCTGAATAAAGAGGGGAGTGGG + Intergenic
1134945767 16:18324291-18324313 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134953028 16:18364427-18364449 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1135311822 16:21411134-21411156 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1135447069 16:22527751-22527773 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136150991 16:28349034-28349056 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136167225 16:28462874-28462896 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136195752 16:28652142-28652164 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136212090 16:28766267-28766289 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136256809 16:29046195-29046217 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136308526 16:29390141-29390163 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136321941 16:29491667-29491689 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136393086 16:29977639-29977661 CAGGGAATGAGGGGAGGAGATGG + Intronic
1136436622 16:30231640-30231662 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1137451025 16:48573940-48573962 CTTTGAATAAGCTGAGGAGGAGG + Intronic
1138255436 16:55554465-55554487 CTGTGAAGACTGAGAGGTGAGGG - Intronic
1138612981 16:58142122-58142144 CTGGGAATAAGCAGACAAGATGG - Intergenic
1139004978 16:62559083-62559105 CTCTGCTTAAGGAGAGAAGAGGG - Intergenic
1139856227 16:69982550-69982572 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1140366501 16:74385527-74385549 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1141739749 16:85883409-85883431 AGGAGAATAAGGAGAGGACATGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1141942537 16:87287044-87287066 GTGGGAAAGAGGAGAGGAGAGGG + Intronic
1142112693 16:88340734-88340756 CTGGGAATCAGCAGAGGGGAGGG + Intergenic
1144162061 17:12569406-12569428 ATGCGGATAGGGAGAGGAGATGG + Intergenic
1144391785 17:14800359-14800381 CTGTGAATAGGGAGCTGTGATGG + Intergenic
1144688245 17:17241326-17241348 CTGTGAATAAGAAAATGTGATGG - Intergenic
1145065137 17:19757017-19757039 CTGTGATTACGGAGCAGAGACGG - Intergenic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1147606397 17:41776071-41776093 CTGGAAATAAGGACAGGAGTGGG + Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1148693852 17:49547714-49547736 GTGTGAACTAGGAGAGGACAGGG + Intergenic
1149219305 17:54397749-54397771 CTGAGAATCAGGAGAGCTGATGG - Intergenic
1149650812 17:58275336-58275358 CTGCGAAGAAGGAGAGGGAAGGG + Intronic
1149654744 17:58304407-58304429 CAGGGAACAAAGAGAGGAGATGG + Intronic
1149728482 17:58921685-58921707 CAGTGAATCAGTAGAAGAGATGG + Intronic
1150600281 17:66645360-66645382 CTGTGAATCAAGAAAGGAGAGGG - Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1152417287 17:80170843-80170865 TTCTGAAAAAGGAGAGAAGAGGG - Intronic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153301198 18:3593582-3593604 GTGTGTGTAAGGGGAGGAGAGGG + Intronic
1153356650 18:4144006-4144028 CTCTGCTTGAGGAGAGGAGAAGG - Intronic
1154117699 18:11625776-11625798 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1155317051 18:24582288-24582310 CTGAGAATAGTGAGAGAAGATGG - Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156705435 18:39875808-39875830 CTTTGAGTAAGCACAGGAGAAGG - Intergenic
1157158825 18:45293537-45293559 CTGAGAATTAGGAGAAGAGGGGG + Intronic
1157630754 18:49092960-49092982 CAGTGAATAAGGAGAGTTGAAGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158062268 18:53359407-53359429 ATGTGAAAAATGAGAAGAGAAGG - Intronic
1158074976 18:53517561-53517583 CTGTGAAAAATGAGACGAGAGGG - Intronic
1158735445 18:60074528-60074550 CTGGGAATCAGGAGAGCTGATGG - Intergenic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159122571 18:64187601-64187623 CTGTGAAAAAGGCCAGCAGACGG - Intergenic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1161415463 19:4144243-4144265 GTGTGGATCAGGAGATGAGACGG + Intergenic
1162695965 19:12475699-12475721 GTGTAACTAATGAGAGGAGAGGG + Intronic
1163013570 19:14440415-14440437 TTGGGAACAAGGAGAGGAGATGG + Intronic
1164530558 19:29045138-29045160 CTGAGAACTAGGAGAGCAGATGG - Intergenic
1164572868 19:29386713-29386735 CCTTGAAGAAGGAGAAGAGAAGG + Intergenic
1165746244 19:38231367-38231389 GTGCGAAAAAGAAGAGGAGAAGG - Intergenic
1166002786 19:39888045-39888067 ATGTGAAGAATCAGAGGAGAAGG + Intronic
1166005573 19:39904297-39904319 ATGTGAAGAATCAGAGGAGAAGG + Intronic
1166080250 19:40439698-40439720 CTGAGATACAGGAGAGGAGAAGG - Intergenic
1167452444 19:49580039-49580061 CTGTCAAAAAGGTGAAGAGAAGG + Intronic
1167702271 19:51056502-51056524 CTGGGAATAAGGAGCAGAGAAGG + Intronic
925144403 2:1571361-1571383 CTTAGAAGAAGGGGAGGAGATGG - Intergenic
926124343 2:10262738-10262760 GTGTGTCCAAGGAGAGGAGATGG + Intergenic
926629436 2:15123315-15123337 CTTTCACTAAGGAAAGGAGAAGG + Intergenic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
927394182 2:22630671-22630693 TGGTGAACAAGGAGAGGAGAGGG - Intergenic
928864040 2:35895936-35895958 CTCTGACTGAGGAAAGGAGAGGG - Intergenic
930765269 2:55078929-55078951 TTGGGAATAAGGAGAGGAAATGG + Intronic
931012226 2:57929962-57929984 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931247463 2:60503467-60503489 CTGTGAATAGGTGGAGGAGAGGG - Intronic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
933623894 2:84576380-84576402 CTTATAATTAGGAGAGGAGATGG + Intronic
933692983 2:85194102-85194124 ATGTGAATGAAGAGAGGAGAAGG + Intronic
935098147 2:99967166-99967188 CTGTGTATAAGGGTAAGAGATGG - Intronic
935356643 2:102207635-102207657 TTCTGCTTAAGGAGAGGAGAGGG - Intronic
935576628 2:104717819-104717841 CTTTGCTTGAGGAGAGGAGAGGG - Intergenic
935809049 2:106778034-106778056 ATGTGAAGAAAGAGAGAAGATGG + Intergenic
936043571 2:109168751-109168773 CTGTGAAGAAGGCAATGAGAAGG - Intronic
936267725 2:111023208-111023230 CTGTGCACAGGGAGATGAGAGGG + Intronic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936597987 2:113867512-113867534 CAGGGAACAAGGAGAAGAGAGGG - Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937791481 2:125967315-125967337 CTCTGGTTAATGAGAGGAGATGG - Intergenic
937812090 2:126210657-126210679 CTGGGAGGAAGAAGAGGAGAGGG + Intergenic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
938162365 2:128997377-128997399 CCGTGAGTTAGGGGAGGAGAAGG - Intergenic
938710053 2:133968571-133968593 CTGTGACTCAGGAGCAGAGATGG + Intergenic
938747529 2:134293883-134293905 TTCTGTATGAGGAGAGGAGATGG - Intronic
939325694 2:140685139-140685161 CTGTGAATGAAGAAAGTAGAGGG - Intronic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939743486 2:145939215-145939237 ATGTGACTCAGGAGAAGAGAAGG - Intergenic
940166439 2:150778899-150778921 CTGTGAATAGTCTGAGGAGAAGG + Intergenic
940468615 2:154064476-154064498 TTCTGCTTAAGGAGAGGAGAGGG + Intronic
941675350 2:168338067-168338089 CTGAGAATCAGGACAGTAGATGG + Intergenic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941910669 2:170761700-170761722 TTATGAATAAGAAGAGGAAAGGG + Intergenic
942144109 2:173008958-173008980 CTGAGAATCAGAAGAGGTGAAGG - Intronic
942568210 2:177287658-177287680 CTGTGATGAAGTAGAGCAGAGGG - Intronic
944486271 2:200209638-200209660 CTGAGAATAAGGGAAGAAGATGG + Intergenic
944707240 2:202302966-202302988 CTGTGAAGAAGAAGAAGAAAAGG + Exonic
944781579 2:203023831-203023853 ATGAGAATAAGAAGAGAAGAAGG + Intronic
946406320 2:219493799-219493821 CCAGGAATAAGGAGAGGTGAGGG - Intronic
947386332 2:229594286-229594308 CTGAGAAAAAGAAGAGCAGAGGG + Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
948712506 2:239833755-239833777 CTGTGAAGAAGGGGAAGAGGGGG + Intergenic
1169406635 20:5326742-5326764 CTCTGCACAAGGAGAGGAGTGGG - Intergenic
1169735812 20:8836386-8836408 CTGAGAATGAGGAGAGCTGATGG + Intronic
1170282730 20:14669205-14669227 CTGTAACTCTGGAGAGGAGATGG - Intronic
1170709311 20:18775736-18775758 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171029406 20:21663819-21663841 CTGGGAAGAGGTAGAGGAGATGG + Intergenic
1172418885 20:34797222-34797244 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1172434614 20:34920353-34920375 GTGTGATAAAGGAGATGAGATGG + Intronic
1173005575 20:39137367-39137389 TCATGACTAAGGAGAGGAGATGG + Intergenic
1173558337 20:43983658-43983680 ATGTGAATAATGAGGGTAGATGG + Intronic
1173754420 20:45502901-45502923 CAGGGAAGAAGGAGAGGAGAGGG + Intergenic
1174643153 20:52062705-52062727 CAGTGAACAAAGAGAGGAGAGGG + Intronic
1174690995 20:52504213-52504235 CTCTGATTTAGGAGAGGAGAGGG + Intergenic
1174985664 20:55448738-55448760 CTCTGGATAAGAAGAAGAGAGGG - Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1177654118 21:23995021-23995043 TGATGAATAAGTAGAGGAGAAGG - Intergenic
1177943411 21:27438899-27438921 CTGAGAAAGAGGAGAGGAGAAGG - Intergenic
1178491837 21:33057507-33057529 CTGGGGATGCGGAGAGGAGAGGG - Intergenic
1179505674 21:41838670-41838692 CTGTGAATAGGCAGAGAAGATGG - Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1182011650 22:27006297-27006319 CTGTGAGCAAGGACAGCAGAGGG - Intergenic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183792853 22:40087795-40087817 CAGGGAATTAGGAGAGGAGCTGG + Intronic
1184120500 22:42446654-42446676 CTTATAAGAAGGAGAGGAGACGG + Intergenic
1184142077 22:42583786-42583808 CTGTGCAGAAGGAGAGGAAGGGG - Exonic
1184391956 22:44207802-44207824 CTGTGAATTGGGAGCTGAGAAGG - Exonic
1185118754 22:48953051-48953073 CTGAGCAGAAGGGGAGGAGAAGG - Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949382811 3:3464969-3464991 CTGAGAATTAGGAGGGGAAAAGG + Intergenic
949748035 3:7317811-7317833 CTGTCAAGAAGAAGAGGTGAGGG + Intronic
951104870 3:18731016-18731038 TTATGAATGAAGAGAGGAGAGGG + Intergenic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
952051317 3:29387893-29387915 CAGTAAATTAGGAGAGAAGAAGG - Intronic
953853325 3:46482463-46482485 CTGTCAAAAAAGAAAGGAGAAGG + Intronic
954364538 3:50139039-50139061 GTGTGAATAGGGGGAGGGGAAGG + Intergenic
954445294 3:50543054-50543076 TTGTGAGTAAGGCGAGGACAGGG - Intergenic
954718439 3:52539048-52539070 CTGTGAAGGAAGAGAGGAAATGG + Intronic
954967279 3:54622953-54622975 CTGTGATTAAGAAGGGGAGGAGG + Intronic
955075158 3:55606823-55606845 CTGTAAAGAAGAAGAGGAGGAGG - Intronic
955799832 3:62674591-62674613 CTGTGCCTAAGAAGAGGAGGTGG + Intronic
955921010 3:63955348-63955370 CTTTGAATCAGCAGTGGAGATGG + Intronic
956014250 3:64864489-64864511 AGATAAATAAGGAGAGGAGATGG + Intergenic
956198302 3:66676397-66676419 CCGTAGATAAGGAGAGGATAGGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957767119 3:84639556-84639578 GTGTGAGTAAGGAGAGCATATGG - Intergenic
957965787 3:87321371-87321393 CTCTGCCTTAGGAGAGGAGAGGG + Intergenic
958620666 3:96555227-96555249 CAGTGAATGTGGAGAGGATATGG - Intergenic
958669178 3:97180754-97180776 TTCTGCTTAAGGAGAGGAGAGGG - Intronic
958832094 3:99101571-99101593 CTGAGAACAAGGAGAGTTGAAGG + Intergenic
958991697 3:100853721-100853743 ATGGGAATAACGAGGGGAGATGG - Intronic
959448338 3:106467658-106467680 TTCTGCTTAAGGAGAGGAGAGGG - Intergenic
959866633 3:111278070-111278092 CTGTGAAGCAGGTGAGGAGTGGG + Intergenic
960684212 3:120280698-120280720 GTGTGAGTAAGGAGAGAAGGTGG - Intronic
961304017 3:125942967-125942989 TTGGGAATAGGGACAGGAGATGG + Intergenic
961949181 3:130729365-130729387 CTGTGAATAAACAGAAGACAGGG + Intronic
962810417 3:138954909-138954931 CTGTGAAGAAGAAGAGGATGGGG + Intergenic
963044137 3:141090093-141090115 CTGGGAAGCAGGAGAAGAGAGGG - Intronic
963160685 3:142148823-142148845 CTGTGAGTCATGAAAGGAGAAGG + Intronic
963622115 3:147623732-147623754 ATGGGAATAAGGAGCAGAGATGG + Intergenic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
964833362 3:160910316-160910338 CTGTCAAAAAGGGGAGGGGAGGG - Intronic
964961106 3:162427742-162427764 CTGTGCCTATGGAAAGGAGATGG + Intergenic
965145045 3:164890263-164890285 CTCTGCTTGAGGAGAGGAGATGG - Intergenic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
965610123 3:170535060-170535082 CCATGGAAAAGGAGAGGAGAAGG - Intronic
965661706 3:171048780-171048802 ATGTGAATAAAAAGAGGAAAAGG + Intergenic
965694396 3:171392342-171392364 CTATGAGAAAGGGGAGGAGAGGG + Intronic
965744599 3:171911633-171911655 CTTTCAAAAAGTAGAGGAGAAGG - Intronic
967049059 3:185765443-185765465 CTGAGATTAAGGAGGGGAGGTGG - Intronic
967875739 3:194267496-194267518 CTGTGACGAAAGAGAGCAGAGGG - Intergenic
969702500 4:8775393-8775415 CTATGAATTTGGAAAGGAGAGGG - Intergenic
971232894 4:24814810-24814832 GAGGGAATAAGGAGAGGAGTTGG - Intronic
971701544 4:29984186-29984208 TTCTGTTTAAGGAGAGGAGAAGG + Intergenic
972238736 4:37165224-37165246 CTGGGAGTAAGGACAGCAGATGG - Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
973730473 4:53817580-53817602 CAGTGAACAAGCAGAGGAGTGGG - Intronic
973829360 4:54742865-54742887 GTGGGAACAAGGAGAAGAGAAGG + Intergenic
973846769 4:54920871-54920893 ATGTGAACTAGGAGAAGAGAAGG - Intergenic
974403634 4:61437457-61437479 CTGTGAATGATGAGATGAGTGGG - Intronic
975029150 4:69592193-69592215 CTGAGATTCAGGAGAGGAGAAGG - Intronic
976082881 4:81375683-81375705 TTCTGTTTAAGGAGAGGAGAGGG - Intergenic
976479434 4:85522915-85522937 GTTTGAATAAGCAGAGGAAAAGG - Intronic
976943810 4:90739366-90739388 CTCTGCTTAAGGAGAGGAGGGGG - Intronic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
977138427 4:93336162-93336184 CTGTAAAGAAAGAGAGGAGAAGG - Intronic
977160594 4:93629408-93629430 ATGTGTATAAAGAGAGGAGCTGG - Intronic
977307407 4:95342258-95342280 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
978120825 4:105077535-105077557 CTGTGCCTAAGCAGAGGAAAGGG + Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978779436 4:112534850-112534872 TTTTGAATAAGGACAGGAGCTGG + Intergenic
979093283 4:116515562-116515584 CTGTGAATGAGGAGCAGATAAGG + Intergenic
981225488 4:142289515-142289537 CTGGGAAGAGGGAGAGGATAAGG - Intronic
982142977 4:152346674-152346696 CTGACAATGAGGGGAGGAGAAGG - Intronic
982391450 4:154868726-154868748 CTGAGAATCAGGAGAGCTGATGG - Intergenic
983106897 4:163697676-163697698 CTGTGTCTAAGGACAGGAGATGG + Intronic
983317848 4:166154861-166154883 CTGTGCATAAGCAAAGGAGTTGG + Intergenic
985240153 4:187922472-187922494 CAGTGAGTAAGGAAAAGAGAAGG + Intergenic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986394145 5:7311762-7311784 CTGCCAAACAGGAGAGGAGATGG + Intergenic
986885294 5:12226442-12226464 CTCTGCTTAAGGAGAGGAGATGG - Intergenic
987395864 5:17422752-17422774 CTGTGAATAAAGAGAAGAATTGG - Intergenic
987903834 5:24050432-24050454 CTCTGCTTAAGGAGAGGAGAGGG + Intronic
987944432 5:24585851-24585873 CTGTGAATCATGAGAGGACTAGG - Intronic
988162166 5:27532537-27532559 CTGTAAATAAGAAGAGGAAAAGG + Intergenic
988230412 5:28470962-28470984 CTGTGAAGTAGGATAAGAGACGG - Intergenic
988398870 5:30734692-30734714 CTGAGAATGAGGAGAGCAGAGGG + Intergenic
988617505 5:32789606-32789628 CTGTGAATAGGGAGAAGTGAGGG - Exonic
988838374 5:35057166-35057188 CTGAGAAAAATGAGGGGAGATGG - Exonic
989559995 5:42839367-42839389 ATGTGAATAAAGAGAGAAGATGG + Intronic
989671765 5:43925390-43925412 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
990128594 5:52550718-52550740 CTGTGAAGTATGAGAGGAGAAGG - Intergenic
990699256 5:58458523-58458545 CATTGACTAAGAAGAGGAGAAGG + Exonic
990923841 5:60996443-60996465 TTCTGTTTAAGGAGAGGAGAGGG - Intronic
991486867 5:67145985-67146007 CTGGGACTAAGGAGGGGAAAGGG + Intronic
991649060 5:68833304-68833326 CTAGGAAAAAGGAGAGGGGAAGG + Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
991979435 5:72215955-72215977 CTGTGAAAAATGAAAGGAGGTGG - Intergenic
992357978 5:76005191-76005213 CTGTGAATGAGGCAAAGAGAAGG - Intergenic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993743886 5:91572460-91572482 CTATGACTAAGGAGAGGAATTGG - Intergenic
993815919 5:92545640-92545662 CTGGAAACAAAGAGAGGAGATGG + Intergenic
994320270 5:98386906-98386928 CCCTGCTTAAGGAGAGGAGAAGG - Intergenic
995635852 5:114189294-114189316 CTGAGAACAAGGAGAGCTGATGG + Intergenic
995713114 5:115054625-115054647 ATGAAAATAAGCAGAGGAGAAGG + Intergenic
996404349 5:123090845-123090867 CTGTGAAGCAGGTGAGGAGAGGG - Intronic
998440110 5:142152548-142152570 CTGGGAGTAAGGAGAGGATTAGG + Exonic
998590902 5:143477113-143477135 CTGTAAATGGGAAGAGGAGAGGG - Intergenic
998883232 5:146666644-146666666 CTATGAAAGTGGAGAGGAGATGG - Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1002069502 5:176670912-176670934 CTGGAAATCAGGGGAGGAGAGGG + Intergenic
1002773135 6:306503-306525 CTATGAACAAGGAGAGGTGGTGG - Intronic
1003314259 6:4997501-4997523 CTGAGAATCAGGAAAGAAGATGG - Intronic
1003438009 6:6111803-6111825 CTCTGCTTGAGGAGAGGAGAAGG - Intergenic
1003487873 6:6595339-6595361 ATGAGAAGCAGGAGAGGAGAAGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1005191664 6:23230404-23230426 TTGTGAAGAGGGAGAGGAGCAGG + Intergenic
1005640788 6:27794124-27794146 CTGAGAATACAGGGAGGAGACGG - Intergenic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006836546 6:37002487-37002509 GTGTGAATCAGGAGACCAGAAGG + Intergenic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1008192016 6:48470924-48470946 CAGTGAATAAGGATAAGAGATGG + Intergenic
1010434443 6:75813578-75813600 CTCTGAATAAGGAAAGGAAAGGG - Intronic
1011271030 6:85580086-85580108 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1011970284 6:93213523-93213545 CTGTAAACAATGAAAGGAGAAGG - Intergenic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1012224443 6:96688389-96688411 TTCTGCTTAAGGAGAGGAGAGGG + Intergenic
1012291276 6:97458567-97458589 CAGCAAATAAAGAGAGGAGAGGG - Intergenic
1012557038 6:100526365-100526387 GTGGGTATAAGGAGAGGAGCAGG + Intronic
1012824175 6:104126417-104126439 CTCTGCATGAGGAAAGGAGAGGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013451341 6:110284599-110284621 CTGTGAATATGAAGAAGTGAAGG + Intronic
1013808970 6:114023187-114023209 CTGGGAATGAGAAGAGGGGATGG - Intergenic
1014295299 6:119610194-119610216 ATGGGAAGAAGGAAAGGAGAAGG + Intergenic
1014383026 6:120767712-120767734 CTGTGGATAAGAAGAGGAAGCGG + Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1017324458 6:153130421-153130443 CTTTGACTAAGGGGAGGGGAAGG + Intronic
1017554244 6:155545862-155545884 TTCTGAATATAGAGAGGAGATGG + Intergenic
1017587871 6:155947041-155947063 CTGGGAACAGGGAGAGGACAGGG - Intergenic
1018205609 6:161434918-161434940 CTGGGAGGAAGGAGAGGGGAGGG + Intronic
1018440201 6:163805524-163805546 CTGGTAATAAGGCAAGGAGAAGG - Intergenic
1019508221 7:1404112-1404134 CTGGGAACACGGAGAGGGGAGGG - Intergenic
1020567936 7:9821679-9821701 ATGTGAATAAGGAAAAGAGCAGG + Intergenic
1020989685 7:15181399-15181421 CAGTGAAGAATGAGAGTAGAAGG - Intergenic
1020991014 7:15196046-15196068 CTGTCAAAAAGGAGAGGAGAGGG - Intergenic
1021239050 7:18178086-18178108 CTGTCAAAGAGGAGAGGGGAGGG - Intronic
1021431093 7:20559884-20559906 GGGTGAATAAGGTGAGGAGGTGG + Intergenic
1021567149 7:22027036-22027058 ATGTAAACAAGGAGAGGAGGAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021787915 7:24171218-24171240 TTGTGAGTAAAGAGAGGAAAGGG + Intergenic
1021842617 7:24733020-24733042 TTGTGCTTGAGGAGAGGAGAGGG + Intronic
1023111894 7:36821785-36821807 CTGAGAATCAGGAGAGCTGATGG + Intergenic
1023111900 7:36821834-36821856 CTGAGAATCAGGAGAGCTGATGG + Intergenic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024191968 7:47021394-47021416 GTGTGAGTAAGGAGAAGATAGGG + Intergenic
1024347858 7:48331045-48331067 GTCTGAATAAGGAGGGAAGAGGG + Intronic
1024395374 7:48860372-48860394 CTGAGAATAAGAAAAGGAGAAGG + Intergenic
1024399862 7:48911916-48911938 CTGAGAATAAGAAAAGGAGAAGG - Intergenic
1024596386 7:50941119-50941141 CTGTGGATGAAGAGAGGAAACGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024791215 7:52966937-52966959 CAGAGAATAAGGAGAGAACAAGG + Intergenic
1026322136 7:69277322-69277344 CTGGGAATCAGGGGAGTAGAAGG - Intergenic
1026414955 7:70170037-70170059 CTGGGAATCAGGAGAGGGGAGGG + Intronic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1027231221 7:76273846-76273868 AGGTGAAGAAGGAGGGGAGATGG - Intronic
1027520291 7:79198342-79198364 CTATCAAAAAGGACAGGAGAGGG - Intronic
1027540666 7:79460184-79460206 CTGGGAACATGGAGAGGAAAGGG + Intergenic
1028127582 7:87131384-87131406 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1028705582 7:93841189-93841211 GTGGGAGTAGGGAGAGGAGAGGG - Intronic
1028747433 7:94343479-94343501 CTGTGAAAGAAGAGAGGAAAGGG - Intergenic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032584413 7:133132945-133132967 CTGTAAATAAGCAAAGAAGAAGG + Intergenic
1032862899 7:135898448-135898470 CTGAGAACAAGGGGAGCAGATGG + Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1034847858 7:154463855-154463877 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1037043269 8:14264267-14264289 GTGTGTTTAAGGAAAGGAGAAGG + Intronic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1038415248 8:27390170-27390192 CTGTGCAGGAGCAGAGGAGAGGG + Intronic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1040701435 8:50070906-50070928 CCATGAAGAAGGAGACGAGAAGG - Intronic
1041061900 8:54042739-54042761 AAGTGAATAAGGATAGGAGTGGG - Intergenic
1041354999 8:56991055-56991077 CTGGGCATTAGGAGAGGGGAAGG + Intronic
1041669159 8:60475618-60475640 AGGTGAAGAAGGGGAGGAGAGGG - Intergenic
1041737001 8:61121381-61121403 CGGTGAATAAGGAGCCAAGATGG - Intronic
1041852294 8:62405157-62405179 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1041998882 8:64097676-64097698 ATGGGAATATGGAGAAGAGAGGG + Intergenic
1041998890 8:64097727-64097749 ATGGGAATATGGAGAAGAGAGGG + Intergenic
1042335197 8:67622560-67622582 CTGGGAATGAGGAGAAGACAGGG + Intronic
1042476011 8:69247909-69247931 CTAGGAGTGAGGAGAGGAGATGG - Intergenic
1042649727 8:71025996-71026018 CAGAGGATGAGGAGAGGAGATGG - Intergenic
1042690440 8:71492350-71492372 CTAAGAATAGGGAGAAGAGATGG + Intronic
1043015344 8:74933255-74933277 CTGTGAATCATGAGTGGAAACGG - Intergenic
1043267283 8:78282316-78282338 CTGGGACTCAGGAGAGGAAAGGG + Intergenic
1043939939 8:86186037-86186059 TTGTCAATAAGAAGAGGAAAAGG + Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1044905656 8:96999370-96999392 CTGGGAAGAGGGAGAGGACAAGG - Intronic
1045278623 8:100729130-100729152 CTTGGAATAAGGAAAGGAAAGGG + Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045800601 8:106096785-106096807 CTCTGCCTAAGGAGAGGAGAAGG + Intergenic
1046141854 8:110104207-110104229 CTGTGAATTAATAGAAGAGAGGG - Intergenic
1046143066 8:110120518-110120540 TTCTGCTTAAGGAGAGGAGAGGG + Intergenic
1046416988 8:113929642-113929664 ATGTGTCTAGGGAGAGGAGAAGG + Intergenic
1046895747 8:119470525-119470547 CTGTGAATAAGGAATTTAGAAGG - Intergenic
1046953978 8:120044573-120044595 CTGTGAATAGGGGGAGGGCAGGG + Intronic
1047468304 8:125141642-125141664 TTGGGAATGAAGAGAGGAGAAGG - Intronic
1047489498 8:125362963-125362985 CAGTGAATAAGCAGTGGAGAGGG - Intronic
1047676532 8:127208806-127208828 CAGTTAAAAAAGAGAGGAGAAGG + Intergenic
1049006493 8:139858939-139858961 CCGTGCAGAAGCAGAGGAGACGG - Intronic
1049219143 8:141420936-141420958 CTGAGAATCGGAAGAGGAGAGGG + Intronic
1049603592 8:143519112-143519134 CTCTGAAGGAGGGGAGGAGAGGG + Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050293392 9:4180180-4180202 CCATGCACAAGGAGAGGAGATGG + Intronic
1050602582 9:7267662-7267684 CTGTGAGAAAGGACAGGAAAGGG - Intergenic
1051289110 9:15527686-15527708 CAGTGACTAAGGAGAGGCGGCGG + Intergenic
1051483602 9:17585236-17585258 ATGAGAATTAGGTGAGGAGATGG + Intronic
1052029510 9:23612104-23612126 CTGTGAATCAGAAGAGCTGATGG + Intergenic
1052082315 9:24222371-24222393 CTGTGAATAGGCAGAGAGGATGG - Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1054785394 9:69205202-69205224 CTGTTAAAAAGTTGAGGAGATGG + Exonic
1054841496 9:69746057-69746079 TTGTGAAAGAGGAGAAGAGAAGG - Intronic
1055158385 9:73094001-73094023 CGGTGATTAAGGACACGAGAGGG - Intergenic
1055825809 9:80323137-80323159 CTTTCAACAAGGAGAGGATAAGG - Intergenic
1056254812 9:84788371-84788393 CTGGGACTATAGAGAGGAGAAGG + Intronic
1056617901 9:88184198-88184220 CCCTGGATAAGGAGAGGAGTGGG + Intergenic
1057869557 9:98708115-98708137 CAGAGAAAAAGGAGTGGAGAAGG - Intronic
1058489042 9:105475452-105475474 GAGTGAATAAGAAGAGGAGTGGG + Intronic
1060982539 9:127802202-127802224 CTGGGAAGAGGGAGAGGGGAAGG + Intronic
1062448038 9:136603972-136603994 CTGGGGATGAGGAGAGGAGGAGG + Intergenic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187410838 X:19049266-19049288 CTGTGCATAAAGAGATGAAAAGG - Intronic
1188161944 X:26815008-26815030 TTCTGCTTAAGGAGAGGAGAAGG - Intergenic
1188996005 X:36887047-36887069 CTGTGCATAGGGTGAGGATAGGG + Intergenic
1190190328 X:48271672-48271694 CGGTGCATGGGGAGAGGAGAGGG + Intronic
1190318711 X:49166818-49166840 TAATGAATAAGGAGAGGAGCAGG - Intronic
1190634206 X:52418486-52418508 CTGGCAATAAGGAGAGGCAAAGG + Intergenic
1190659064 X:52638164-52638186 CGGTGCATGGGGAGAGGAGAGGG + Intergenic
1191852343 X:65594702-65594724 CAGTGAATCAGGAGAGAAGTAGG + Intronic
1192243783 X:69357005-69357027 CTATGCATGAGGAGAGGGGAGGG + Intergenic
1192567426 X:72176965-72176987 CTGGGAACAAGGACAGGAAAAGG - Intergenic
1193213903 X:78840033-78840055 CTGTGCTTGAGGAAAGGAGATGG + Intergenic
1193475336 X:81957029-81957051 ATGAGAATAAGTTGAGGAGATGG - Intergenic
1193643380 X:84039198-84039220 ATGAGATTTAGGAGAGGAGAGGG - Intergenic
1193811541 X:86057118-86057140 CTGCCAAAAAGGATAGGAGAAGG + Intergenic
1193833299 X:86312900-86312922 TGGTGAATCAGGAGAGGAGTGGG + Intronic
1195037962 X:100987367-100987389 CTGTGACAAAAGAGAAGAGAAGG - Intronic
1195199298 X:102532539-102532561 TTCTGCTTAAGGAGAGGAGAGGG + Intergenic
1195594819 X:106675627-106675649 CTGTGACCAAAGAGAGGAAATGG + Intronic
1195595395 X:106683083-106683105 TTCTGCTTAAGGAGAGGAGAGGG + Intergenic
1195943920 X:110189182-110189204 CTGTGTATCAGCATAGGAGATGG - Intergenic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197312517 X:124923283-124923305 TTTTCAATAAGGAGAGGATAGGG - Intronic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198403039 X:136286052-136286074 CTGTCACTAAAGAGAGAAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199158203 X:144574586-144574608 CTGTAGATAAGCAGAAGAGAAGG - Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1202302006 Y:23426543-23426565 CTGGGAGTAGGGAGAAGAGATGG - Intergenic
1202568805 Y:26244055-26244077 CTGGGAGTAGGGAGAAGAGATGG + Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic