ID: 1031936600

View in Genome Browser
Species Human (GRCh38)
Location 7:127741618-127741640
Sequence ATGTTAGCAAAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031936600_1031936605 11 Left 1031936600 7:127741618-127741640 CCTTCCTCACTCTTTGCTAACAT 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1031936605 7:127741652-127741674 GTGTACCTGTTATGGCCCTTAGG No data
1031936600_1031936603 3 Left 1031936600 7:127741618-127741640 CCTTCCTCACTCTTTGCTAACAT 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1031936603 7:127741644-127741666 CTTCCGTTGTGTACCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031936600 Original CRISPR ATGTTAGCAAAGAGTGAGGA AGG (reversed) Intronic
901156170 1:7140937-7140959 AAGGTAGCAGAGAGTGGGGATGG - Intronic
901363249 1:8722228-8722250 AGGTTAGCAAAGGTTGAGGCAGG - Intronic
903427698 1:23266651-23266673 ATTTTGGAAAAGAGTGAGCATGG + Intergenic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
908813918 1:68012226-68012248 AAGTTAACAGAGAGTGAGGGAGG - Intergenic
909283739 1:73789160-73789182 ATGTTAGAAAACACTGAGCATGG - Intergenic
911605967 1:99905524-99905546 ATTTCAGCAAAGAGGGAAGATGG - Intronic
912731189 1:112107011-112107033 ATGTCAGGAAACAGGGAGGAAGG + Intergenic
913513532 1:119583507-119583529 ATGTTAGGACGGAGAGAGGAGGG + Intergenic
913658624 1:120985923-120985945 AGATTAGCAATAAGTGAGGAAGG - Intergenic
914009988 1:143769048-143769070 AGATTAGCAATAAGTGAGGAAGG - Intergenic
914379185 1:147101083-147101105 CAGTTAGCAAAGAGAGAGCAGGG + Intergenic
914648606 1:149677705-149677727 AGATTAGCAATAAGTGAGGAAGG - Intergenic
915334533 1:155133347-155133369 AAGTTAGCAAAAACTAAGGAGGG + Intronic
915914684 1:159933920-159933942 ATGATGGCAAAGAGTCAAGAAGG - Intronic
916079265 1:161222310-161222332 ATTGTAGCAAAGAGTGGGTAGGG + Exonic
917528128 1:175807848-175807870 ATGTAAGCAAAGACTGAAAAGGG - Intergenic
917917242 1:179714727-179714749 ATTTTAAAAAAGAGTGAAGAAGG - Intergenic
918016823 1:180642876-180642898 ATGTTAACACATAGTGAAGAGGG + Intronic
919038204 1:192344424-192344446 ATATTACCAAAGAGTAAAGAGGG - Intronic
919451482 1:197776777-197776799 CTGTTAGTAAAAAATGAGGACGG + Intergenic
919661411 1:200251552-200251574 AGGATAGGAATGAGTGAGGAGGG - Intergenic
919976490 1:202616158-202616180 ATAACAGCAAAGAGAGAGGAGGG - Intronic
920264468 1:204711667-204711689 ATGTAAGCACAGAGTGGGGGTGG - Intergenic
920762142 1:208794773-208794795 AAGTTAAAAAAGAGTCAGGAAGG - Intergenic
921836649 1:219785244-219785266 ATGACAGCAAAGAGCGATGAAGG + Intronic
922201349 1:223404266-223404288 ATGCCAGCAAAGACTGAGGGGGG + Intergenic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
923166452 1:231368347-231368369 ATTATAGCAAAGAGTAATGATGG + Intronic
923409761 1:233695402-233695424 ATGATAGCAAAGACTGAGTGGGG + Intergenic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
1063399398 10:5727756-5727778 AGGTGAGCAAAGAGTGTTGACGG - Intronic
1064304823 10:14155729-14155751 ATGTTAGGAAAGAGTGAGAGTGG + Intronic
1064459690 10:15521941-15521963 AAGCTGGCAAAGAGTGGGGAGGG + Intronic
1064587460 10:16852536-16852558 ATGGAAGCAAAGAGCGAGGGAGG - Intronic
1064814934 10:19250282-19250304 ATTTTAGAAAAAAGTGAAGAAGG - Intronic
1066590362 10:36987889-36987911 ATGTTTGCAAAGAGTTAGTTGGG - Intergenic
1068311886 10:55289456-55289478 ATGGAAGGAGAGAGTGAGGAAGG + Intronic
1068465238 10:57381484-57381506 ATGTCAGCAGGGAGTGAGGTGGG + Intergenic
1068918334 10:62457471-62457493 ATGTGAGCTAAGAGTGGAGAAGG + Intronic
1069021279 10:63491129-63491151 AAGTTGGCAAAGAATGAAGATGG + Intergenic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1071318276 10:84424843-84424865 ATGTAAGCACTGAGTGAAGATGG + Intronic
1071568847 10:86685528-86685550 AGGAGAGCAAGGAGTGAGGAGGG - Intronic
1071925669 10:90406297-90406319 TTGTCAGCAAAGAGTGTTGATGG + Intergenic
1072943992 10:99793303-99793325 ATGTTAGCCAAGAATGTAGAAGG - Intronic
1073363895 10:102920843-102920865 ATGTAAACAAATAGTGAAGAAGG - Intronic
1073676332 10:105650884-105650906 ATGTTTGCAGAGAGTTAGAATGG + Intergenic
1074503573 10:114046118-114046140 ATGAAAGCAAAGAGAAAGGATGG + Exonic
1075919547 10:126198959-126198981 CTGATATCAAAGAGTAAGGAAGG + Intronic
1079773238 11:24490716-24490738 ATGTTAGCAAAGAAAGAACATGG + Intergenic
1081911381 11:46701881-46701903 GTGTCAGCAGTGAGTGAGGAAGG + Intronic
1084803744 11:71564880-71564902 ATGGGAGCAAGGGGTGAGGAGGG - Intronic
1084806621 11:71583641-71583663 ATGGGAGCAAGGGGTGAGGAGGG + Intronic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085897735 11:80660195-80660217 ATGTTTGCAAAGAGTTAGTTGGG + Intergenic
1086258286 11:84906699-84906721 ATTTTAGCAAAGTGTGGGCAGGG + Intronic
1086404162 11:86486020-86486042 ACATCAGCATAGAGTGAGGATGG - Intronic
1088096667 11:106108478-106108500 ATGTGAGCAAATAGAGAGAATGG - Intergenic
1088442152 11:109882761-109882783 ATGTTAGAAAACTGTGAGGCAGG - Intergenic
1088906767 11:114161002-114161024 AAGGTAGCAGAGGGTGAGGAGGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091362382 11:134987708-134987730 AAGGAAGCAAAGAGGGAGGAAGG + Intergenic
1093425369 12:19022760-19022782 ATCTTAACAAGGAATGAGGAGGG - Intergenic
1094008471 12:25781571-25781593 ATGTTGGGAAGGAGGGAGGAGGG - Intergenic
1094550891 12:31450228-31450250 ATGGTAACAAAGTTTGAGGAAGG - Intronic
1094682382 12:32678070-32678092 GTATGAGCAAAGAGTGAGTAAGG + Intergenic
1095882073 12:47148433-47148455 CTGTTAGAAGAGAGTGAGTAGGG + Intronic
1096066878 12:48748085-48748107 AAGTTAGCTCAGAGTGAGAATGG - Intergenic
1097258151 12:57696215-57696237 AAGATAGCAAAGAGGAAGGATGG - Intronic
1098228287 12:68347144-68347166 TTGGTAGAGAAGAGTGAGGAGGG - Intergenic
1100067004 12:90661242-90661264 ATATTATCAAAGACTGAGAATGG + Intergenic
1100265231 12:92969480-92969502 ATGCTAGCAAAGGCTGAGCATGG - Intergenic
1101064427 12:101004609-101004631 ATTATAGAAAAGAGTAAGGAAGG + Intronic
1102935416 12:116892330-116892352 ATATATACAAAGAGTGAGGAAGG + Intergenic
1108559993 13:51633676-51633698 ATTTTAGCAAGAAGTGATGAGGG + Intronic
1109778547 13:67076971-67076993 ATGTTAGCAATGAGCGTGGTGGG - Intronic
1111703780 13:91722768-91722790 TGGTTAGCAAAGAGTAAAGAAGG - Intronic
1111970058 13:94902729-94902751 GTGTCACCAAAGAGTGAGCATGG - Intergenic
1113254758 13:108495391-108495413 ATTGTAGCAGAGAGAGAGGAGGG + Intergenic
1113340475 13:109418978-109419000 ATGTTTGCAAAGAATGATAAGGG - Intergenic
1114345772 14:21793121-21793143 ATGTTAGAAAAAACTTAGGAAGG - Intergenic
1115118675 14:29913497-29913519 AAGTAAACATAGAGTGAGGATGG - Intronic
1115876393 14:37866511-37866533 ATTTTGGCAAAGAGTGAAGATGG + Intronic
1118490346 14:66253037-66253059 AGGTGAGCTAAGAGTGAGCATGG - Intergenic
1119770237 14:77216086-77216108 AAGGTAGAAAAGAGAGAGGAAGG + Intronic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1122522908 14:102358822-102358844 ATCATAGCAAAGTTTGAGGAAGG + Intronic
1123223468 14:106878121-106878143 ACCTTAGAAAAGGGTGAGGAGGG + Intergenic
1124338306 15:28873612-28873634 ATGGTAGAAGAGACTGAGGAAGG + Intergenic
1124910100 15:33911392-33911414 ATGTTAGCAAAAAAGGAGGGGGG - Intronic
1124945551 15:34262410-34262432 CTGATATCAAAGGGTGAGGAGGG - Intronic
1125326241 15:38538487-38538509 ATGTTAGCAAAAAGAGAAGACGG - Intronic
1126426225 15:48529455-48529477 ATGGGAGGAAAGAGTGTGGAGGG + Intronic
1127921321 15:63496658-63496680 ATGTTTGGAAAGAGAGAGCAAGG - Intergenic
1128466724 15:67918748-67918770 ATGCTGACAAAGGGTGAGGAGGG + Intergenic
1128675081 15:69602604-69602626 AAGTTAGCAGAGAGAGAGGGTGG - Intergenic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1130075750 15:80688400-80688422 ATGTGAGGAGAGGGTGAGGAAGG - Intronic
1130718042 15:86355893-86355915 ATGTTTGCAAAGAATGAAGCAGG - Intronic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1136987419 16:35122066-35122088 AGATTAGCAAAGAGTGCAGATGG + Intergenic
1138041724 16:53678552-53678574 ATGTTGGCAAAGGGTGGGGGAGG - Intronic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138663660 16:58543762-58543784 TTGTGAGCAAATAGTCAGGAAGG - Exonic
1139243312 16:65416486-65416508 CTGTTAGCTAAGAGCGTGGATGG - Intergenic
1140050946 16:71480498-71480520 CTGTCAGCAATGAGTGATGATGG - Intronic
1140464946 16:75174034-75174056 TTATTAGCTGAGAGTGAGGATGG + Intergenic
1140573025 16:76130985-76131007 ATATTTACAAAGGGTGAGGAGGG + Intergenic
1141162304 16:81637729-81637751 GAGTGAGCAAAGAGTGATGAGGG + Intronic
1141300389 16:82810291-82810313 ACTTTAGCAAAGAGAAAGGACGG - Intronic
1142288953 16:89183987-89184009 ATGTGAGTACAGGGTGAGGATGG - Intronic
1143208957 17:5169016-5169038 ATGTTAGCGCTGAGTGAGGATGG - Exonic
1143905894 17:10208901-10208923 CTGTTAGGGAACAGTGAGGATGG - Intergenic
1144618448 17:16798491-16798513 ATGTTAGCGCTGAGTGAGGATGG - Intronic
1144894258 17:18517202-18517224 ATGTTAGCGCTGAGTGAGGATGG + Intergenic
1145137973 17:20427040-20427062 ATGTTAGCGCTGAGTGAGGATGG - Intergenic
1147382106 17:40062289-40062311 ATGTTAGAAATGAGAGGGGAGGG + Intronic
1149702860 17:58669815-58669837 ATGTTAACAAAATGTCAGGAAGG + Intronic
1149871173 17:60183182-60183204 ATGTTAGCGCTGAGTGAGGATGG + Exonic
1150601826 17:66657721-66657743 GTATTAGTAAAGAGTAAGGAGGG - Intronic
1151001567 17:70382626-70382648 GTCTTAGCATAGACTGAGGAGGG - Intergenic
1151022397 17:70632456-70632478 ATGTCATAAAAGAGGGAGGAGGG + Intergenic
1151202856 17:72481483-72481505 ATCTTAGGAAAGGGTGAAGAGGG - Intergenic
1152068257 17:78123101-78123123 AGGTTAGATAAGAGTGGGGATGG - Intronic
1152467010 17:80472179-80472201 AGACTAGCAAAGAGGGAGGAGGG - Intronic
1153579392 18:6557163-6557185 ATGTCAGCAAGGGGTCAGGAGGG - Intronic
1154205715 18:12335091-12335113 TTGTGAGCAATGAGTGAGGGAGG - Intronic
1154493105 18:14936365-14936387 AAGCAAGCAAAGAGGGAGGAAGG - Intergenic
1157560528 18:48642439-48642461 ATGTTAGCAAAGGTTGAGTAGGG + Intronic
1158091030 18:53713704-53713726 ATCTTAGCCAAGATTTAGGATGG - Intergenic
1159812325 18:73030580-73030602 TTGTGAGCAAATTGTGAGGAAGG + Intergenic
1159866546 18:73712621-73712643 ATGAAAGGAAAAAGTGAGGAGGG + Intergenic
1163067307 19:14807592-14807614 AGGTTAGCACAGAGTGATCATGG + Intronic
1164433452 19:28208050-28208072 ATGGAAGCAAAGAGAGAGGAAGG - Intergenic
1165224889 19:34347801-34347823 ACGTTAGCAAAGCGTAGGGAAGG + Intronic
1166399980 19:42471455-42471477 ATGTTAACAAGGATTGAGGTGGG + Intergenic
1166794582 19:45418930-45418952 ATGTTGGCAAGGAGAGGGGAGGG - Intronic
1168490666 19:56806121-56806143 ATGTTACCAATCAGTGAAGATGG + Intronic
927281067 2:21307123-21307145 ATGTCAACAAAGAGAGATGAAGG - Intergenic
927372161 2:22368803-22368825 ATGTAAACAAAGAGAGAGAATGG + Intergenic
928328478 2:30338749-30338771 GTGTTAGGAAAGAATGAGGCTGG + Intergenic
930310434 2:49732837-49732859 ATTTTAGCAAAGAGTCTGGTGGG - Intergenic
930776380 2:55175451-55175473 ATGATAGCAAGAACTGAGGAAGG - Intronic
931186266 2:59954372-59954394 ATGTTAGCGAAGGGTGGTGAGGG - Intergenic
931959424 2:67465730-67465752 ATTTTAGCACAGAGAGAGGCAGG + Intergenic
932103436 2:68922108-68922130 ATGCTTGGAAAGAGAGAGGAAGG + Intergenic
932310455 2:70735580-70735602 TTGTTAGGAAAGAGGGAGGAGGG - Intronic
933254391 2:80064151-80064173 ATGTCAGCTTAGAATGAGGAAGG - Intronic
937423243 2:121775904-121775926 GTGATAGCAGAGAGAGAGGATGG - Intergenic
937699820 2:124851675-124851697 TTATTAGCTGAGAGTGAGGAAGG + Intronic
938443705 2:131359566-131359588 TTATCAGCAAAGAGTGAAGATGG - Intergenic
939423100 2:141999094-141999116 ATGTTAGCCTAGAGTCAGGATGG + Intronic
939691584 2:145268529-145268551 ATGTTAAGAAAGAGTAAGCATGG - Intergenic
939902528 2:147867634-147867656 TTTCTAGCAAAGAGTGTGGAAGG - Intronic
940112727 2:150171591-150171613 ATGATAGAAAAAAGTGAGTATGG + Intergenic
942077152 2:172366490-172366512 CTGTTAGCCAAGACTGAGAAAGG - Intergenic
942593924 2:177574360-177574382 AAGTTCTCAAAGGGTGAGGAGGG + Intergenic
942703809 2:178745655-178745677 AGCTTAGTAAAGAGTGATGAAGG - Intronic
942834618 2:180278452-180278474 ATGTTAGGACACAGTGAGGTTGG - Intergenic
947040992 2:225919445-225919467 ATGTTAGTATCAAGTGAGGAAGG - Intergenic
948284413 2:236772661-236772683 ACTTTAGCAAAGACTGAGGCAGG - Intergenic
948836827 2:240629904-240629926 AGGTCAGCAGAGAGTGAGCAGGG - Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1173369144 20:42419338-42419360 GCTTTAGCAAAGAGTGAAGAGGG + Intronic
1177056911 21:16317774-16317796 ATGAAAGCAAAGAGAGGGGAAGG - Intergenic
1180681145 22:17627904-17627926 ATGATAGGAAACAGTGCGGAGGG - Intronic
1181447900 22:22992746-22992768 AAGTTAGGAAAGAATGACGATGG - Intergenic
1181749934 22:24982333-24982355 TTTTTAGCAAAGAGAGAGTAAGG - Intronic
1182428619 22:30287700-30287722 ATGTGTGCAAAGACTGAGAAAGG + Intronic
1183101017 22:35584109-35584131 ATGTTAGCAAAAATAGCGGAAGG + Intergenic
1184642457 22:45879640-45879662 ATGATAGCAAGGAGGGAGGGAGG - Intergenic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
951082089 3:18464587-18464609 CTGTTAGAAGAGAGTGTGGAAGG - Intergenic
951394579 3:22149802-22149824 AGGATAGCAAAGAGGGAGAAAGG - Intronic
952022742 3:29042259-29042281 ATGTCAGCAAAGATGGAGCAGGG - Intergenic
960486768 3:118262136-118262158 ATGTGATCCAAGAATGAGGATGG + Intergenic
961204114 3:125067315-125067337 AGGTCAGAAAAGAGAGAGGAAGG + Intergenic
961861623 3:129921037-129921059 AGGTCAGCAAGGAGTGAGGTTGG + Intergenic
962405694 3:135097959-135097981 AAGTTGGCACAGAGGGAGGATGG - Intronic
963215418 3:142740853-142740875 AAGTTAGCAAAGAGTGATGAAGG + Intronic
963216214 3:142751739-142751761 AGGTGAGGAAAGAGTGAGGGTGG - Intronic
963617348 3:147558696-147558718 CTGTTAGGAAAGGGAGAGGAGGG - Intergenic
964359168 3:155876363-155876385 TTATTAGAAAAGAGTAAGGAAGG + Intronic
965810352 3:172585372-172585394 ATGTTAGCAAAGAAGGAGAAAGG - Intergenic
966119161 3:176503036-176503058 CTGTTAGCAAAGTGTGTGTAAGG - Intergenic
966283157 3:178258863-178258885 AAGTTACCAAAGACAGAGGAGGG + Intergenic
966299676 3:178463812-178463834 ATTTTAGCAAAAAGTCAGGGAGG + Intronic
967298474 3:187988458-187988480 ATGTAAGAAAAGAGTAAGCAGGG - Intergenic
969496458 4:7529196-7529218 ATGTTTGCACAGAGTCTGGAAGG - Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971530505 4:27682431-27682453 ATGGTAGCAAAGAGAGTGAAGGG + Intergenic
971703891 4:30014440-30014462 ACGTCTGCAAAGAGTGAGAAAGG - Intergenic
974227122 4:59060540-59060562 GTGGTAGCAGAGAGGGAGGAGGG + Intergenic
974776125 4:66483775-66483797 ATTATGGCAAAGAGTGAAGAGGG - Intergenic
975329329 4:73096578-73096600 AAGTTATCAAAGAGTGACAATGG + Intronic
975969490 4:80016365-80016387 ATGTCAGCAAAGAAAGGGGATGG - Intronic
975974138 4:80075660-80075682 CAGTTGGCAAAGAGTGAGAAGGG - Intronic
978078282 4:104560810-104560832 ATGTTAGCAATGAGAGCAGATGG - Intergenic
978698597 4:111615286-111615308 GTGTTAGCAAAGAGCTAAGATGG - Intergenic
978830514 4:113078638-113078660 AGGTTAGGAAAGATTAAGGAAGG + Intronic
979207633 4:118059280-118059302 ATGTAAGAAAATAGTGAGAAAGG - Intronic
979240063 4:118440063-118440085 ATGTTATGAAAGAGTCAGGCTGG + Intergenic
980204748 4:129702855-129702877 ACGTGAGCAAAGAGTGGGGCAGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
982232410 4:153221725-153221747 AAGGAAGGAAAGAGTGAGGAAGG + Intronic
983194858 4:164795956-164795978 ATGTCAGCAAGGAGTGAAGGTGG - Intergenic
983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG + Intergenic
983842014 4:172468846-172468868 ATGTTAGAGAAGAGTGTAGAAGG - Intronic
984434307 4:179689149-179689171 ATTCTAGCAAAGTATGAGGAAGG - Intergenic
985003728 4:185512030-185512052 GTTATAGCAAATAGTGAGGAGGG + Intronic
986984175 5:13481269-13481291 ATCTTATCATAGAGTGTGGAAGG + Intergenic
988018864 5:25597437-25597459 TTGTGAGAAAACAGTGAGGATGG - Intergenic
988678391 5:33458065-33458087 ATGTTGGCAAGGAGGTAGGAGGG + Intronic
989727272 5:44601528-44601550 ATTTTAGGAAAAAGTGAAGAAGG - Intergenic
990063292 5:51679526-51679548 AGGCTAGGAAGGAGTGAGGAAGG + Intergenic
991193963 5:63909979-63910001 ATGATTGCAAATAGTGAGGTAGG + Intergenic
994357479 5:98810257-98810279 ATCTTACCAAAGAGTGAGGCTGG - Intergenic
994548393 5:101200646-101200668 ATGTTAACAAAGCGCAAGGAAGG - Intergenic
996191656 5:120550755-120550777 ATGTTAACAATGAGAAAGGAAGG - Intronic
996196712 5:120616264-120616286 ATGTTACCAAAGTGTAAGGTGGG + Intronic
996343686 5:122467033-122467055 ATGACAGCAAAGAGGGAGGGAGG - Intergenic
997944633 5:138189030-138189052 TTGTTAGCAGAGAGTGAAGCAGG + Exonic
998383801 5:141744369-141744391 ACAGTAGCAAAGAGAGAGGAGGG + Intergenic
1001053740 5:168432743-168432765 ATGTAAACAAACTGTGAGGAGGG + Intronic
1002048150 5:176553563-176553585 ATGAGAGAAAAAAGTGAGGAGGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1004184928 6:13413574-13413596 AGGTAAGCCAAGAGTGAGGCAGG + Intronic
1004238150 6:13893896-13893918 ATGTGAGGACAGAGTGAGGGGGG + Intergenic
1005516235 6:26557042-26557064 ATGTTAGTGAAGTGAGAGGAAGG - Intergenic
1006101019 6:31686497-31686519 ATCTTGGTGAAGAGTGAGGAAGG - Intergenic
1006169117 6:32082952-32082974 ATGAGAGCAAAGAGGGAAGATGG - Intronic
1008168283 6:48168008-48168030 ATGCCAGCAAAGTCTGAGGAGGG + Intergenic
1008904095 6:56657325-56657347 ATGTTAGCAAGGAGGGAGGGTGG + Intronic
1009299408 6:61995698-61995720 ATTTTAACTAAGAGTGGGGAAGG + Intronic
1009973437 6:70648583-70648605 ATGTGAGGAATCAGTGAGGAGGG + Intergenic
1013129498 6:107218719-107218741 AAGTTAGGAAAGATAGAGGAAGG - Intronic
1015570839 6:134619783-134619805 TTATTAGCTAAGAGTGAGAATGG + Intergenic
1017329803 6:153183140-153183162 TTGTTAGCTGAGAGTGAGGATGG + Intergenic
1018750988 6:166805636-166805658 ATGTTAGCAAATCCTGAGGAAGG + Intronic
1020029959 7:4925690-4925712 ATGATCGGAAAGAGTGAGGGAGG - Intronic
1020506057 7:8989567-8989589 CTGTTAGAAAAGAGTGGTGAGGG - Intergenic
1020909089 7:14105566-14105588 ATGTTAGAAAAGATTGAGGGGGG + Intergenic
1021286414 7:18786669-18786691 ATGTGAGCAAAAAGGAAGGAAGG - Intronic
1021773631 7:24029974-24029996 AAGTTAGCTGAGAGTGATGATGG + Intergenic
1022361387 7:29662880-29662902 ATGTGGGCAAAGAGAGACGAAGG - Intergenic
1022781372 7:33587786-33587808 ATGCTAGTAAAGAGTTAGGGAGG + Intronic
1022935942 7:35176556-35176578 ATGTGGGCAAAGAGAGATGAAGG + Intergenic
1023484189 7:40666517-40666539 ATGTTTTCAAAGAATGAAGAAGG + Intronic
1024642226 7:51339490-51339512 ATTGTAGCAAAGGGTGGGGAGGG + Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1028118343 7:87027637-87027659 AGATAAGCATAGAGTGAGGATGG + Intronic
1030092428 7:105869255-105869277 TTGTTAGCAAAAGGGGAGGAAGG + Intronic
1030306439 7:108023776-108023798 AAGTTAGGAAAGAGAAAGGAAGG + Exonic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1030519658 7:110582044-110582066 ATGTTAGGAAAGAATGGGGAGGG + Intergenic
1030789495 7:113706391-113706413 ATTTGAGCAAAGAGTCAAGAAGG - Intergenic
1030885694 7:114933891-114933913 ATTTTAGCCAAATGTGAGGATGG + Intronic
1031936600 7:127741618-127741640 ATGTTAGCAAAGAGTGAGGAAGG - Intronic
1031949696 7:127879504-127879526 AGGTTAGAAACGAGTAAGGAAGG - Intronic
1032225050 7:130024448-130024470 ATGTTCGCAATGTATGAGGAAGG - Exonic
1032650941 7:133877790-133877812 AGCTTCGCAAAGAGAGAGGAGGG - Intronic
1032948063 7:136874272-136874294 CTATTAGCAAAGAATGAGGTAGG + Intronic
1035407471 7:158608954-158608976 ATGTTAGCAAGGGCTGGGGATGG + Intergenic
1035951520 8:4027278-4027300 ATGTTAGGAGAGAGTGAGTCAGG + Intronic
1036006113 8:4665293-4665315 AAGTCAGCAAAGGGAGAGGAAGG - Intronic
1036455518 8:8903336-8903358 ATGTTAGGACAGAGTCAGGTTGG - Intergenic
1036719428 8:11159458-11159480 CTGTTAGCAGAAAGTGAGGCGGG - Intronic
1037347176 8:17913058-17913080 ACATTAGGAAAGAATGAGGATGG - Intergenic
1038401742 8:27289091-27289113 ATGTTAGCAAAGAGGCACCAGGG - Intronic
1039824059 8:41158012-41158034 GAGTTTGGAAAGAGTGAGGAAGG - Intergenic
1042719935 8:71816484-71816506 TGGTTAGGGAAGAGTGAGGAAGG - Intergenic
1043474446 8:80592661-80592683 AGGTCAATAAAGAGTGAGGAAGG - Intergenic
1045475492 8:102548978-102549000 ATGTCAGCAAAGATTGAAGCAGG - Intergenic
1045950680 8:107848655-107848677 AGGTAAGCAAAGAATGAAGAGGG - Intergenic
1047827832 8:128596869-128596891 TTATTAGCTGAGAGTGAGGAAGG + Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1049131758 8:140851026-140851048 TTGGTAGCAAAGAAAGAGGATGG + Intronic
1051057767 9:13008206-13008228 ATGTTAGTAAAGGGTAAGGAAGG - Intergenic
1053398363 9:37796183-37796205 GTGTTAGCAAAGCGTGGAGAGGG - Intronic
1054839600 9:69722434-69722456 CTGGTAGCAAAGAGTGAAAAAGG - Intronic
1054850499 9:69842311-69842333 ATGTAAGCAAGGAGAAAGGATGG + Intronic
1055651015 9:78407192-78407214 ATGAAAGCCAAGAGTGAGGCAGG - Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1057066687 9:92059799-92059821 ATGTCAGCAAAGGCTGAGAAGGG + Intronic
1058009944 9:99965846-99965868 GTGTTTGCAAAGTGTGAGGGGGG - Intronic
1060431677 9:123556197-123556219 ATGTGAGCACACAGTGACGATGG + Intronic
1062228833 9:135469709-135469731 TTGTGAGCAAACAGTGAGGGGGG - Intergenic
1186175568 X:6922629-6922651 TTGTAAGCTGAGAGTGAGGATGG - Intergenic
1187223118 X:17348499-17348521 ATTTTAGCAAAGAGCCAAGATGG - Intergenic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1191667052 X:63714262-63714284 ATGATAGAAAAGAGTAGGGAAGG - Intronic
1193453306 X:81698316-81698338 ATGTTAGTAAAGAGGCAGAATGG + Intergenic
1194414358 X:93592180-93592202 ATCTAAGCAAAGAGTTAAGAAGG - Intergenic
1194748916 X:97662194-97662216 ATGTTACCAAGCAGTAAGGAAGG + Intergenic
1194936802 X:99959911-99959933 AGGCTAGGAAAAAGTGAGGAAGG - Intergenic
1195600060 X:106736393-106736415 ATGTTATGAAAGACAGAGGAGGG - Intronic
1196389947 X:115196489-115196511 ATGTTGGCATAGGGTTAGGAGGG - Intronic
1197197164 X:123714369-123714391 ATGTTAGCCAAGAGAGAACAGGG + Intronic
1198230406 X:134683810-134683832 ATGTTGGCACAAAGTGAGGTTGG - Intronic
1199681169 X:150225569-150225591 TTCTTAGAAAAGTGTGAGGAGGG - Intergenic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200753530 Y:6968704-6968726 ATGTTCTGAAAAAGTGAGGAGGG - Intronic
1200950784 Y:8897718-8897740 AAGTGAGCAAAGAGTTGGGAAGG - Intergenic
1201696216 Y:16829337-16829359 TTGTGAGCAAAGAGTGGAGAAGG - Intergenic
1201786037 Y:17780270-17780292 ATTTGAGCAAAGAAAGAGGATGG - Intergenic
1201815516 Y:18125718-18125740 ATTTGAGCAAAGAAAGAGGATGG + Intergenic