ID: 1031937527

View in Genome Browser
Species Human (GRCh38)
Location 7:127750987-127751009
Sequence CTGTATCTTGTCTGTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031937524_1031937527 12 Left 1031937524 7:127750952-127750974 CCTAGTCTTCACTCTGGGATGCA 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG No data
1031937520_1031937527 24 Left 1031937520 7:127750940-127750962 CCTTCCATTTAACCTAGTCTTCA 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG No data
1031937519_1031937527 25 Left 1031937519 7:127750939-127750961 CCCTTCCATTTAACCTAGTCTTC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG No data
1031937521_1031937527 20 Left 1031937521 7:127750944-127750966 CCATTTAACCTAGTCTTCACTCT 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031937527 Original CRISPR CTGTATCTTGTCTGTTTTGG TGG Intronic
No off target data available for this crispr