ID: 1031938262

View in Genome Browser
Species Human (GRCh38)
Location 7:127759189-127759211
Sequence ATGTAGTATGTGACTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031938262 Original CRISPR ATGTAGTATGTGACTTAAGA TGG Intronic
904200169 1:28814427-28814449 CTGTAGAATCTGACTAAAGAAGG + Intronic
911432670 1:97811661-97811683 TTTTAGTATGTGTATTAAGATGG - Intronic
912215510 1:107606864-107606886 TTGTTGTTTGTTACTTAAGAAGG + Intronic
913071395 1:115302226-115302248 ATGTAGTGTTTTATTTAAGAAGG + Intronic
915692121 1:157700155-157700177 ATTTAGTCTGAGGCTTAAGAGGG + Intronic
918209962 1:182341716-182341738 TTGTAGTATGTAACTTCACAGGG + Intergenic
919231114 1:194775742-194775764 ATGTATTATTTGACTTCAGAAGG - Intergenic
921240458 1:213175879-213175901 ATGTATTATGTGTTTTCAGAGGG - Intronic
921518904 1:216134277-216134299 ATGTACAATTTGACTCAAGAGGG + Intronic
922300113 1:224291706-224291728 ATGATGTTTTTGACTTAAGATGG - Intronic
924281396 1:242440726-242440748 GTTTAGTCTGTGAGTTAAGAAGG - Intronic
924551656 1:245083667-245083689 ATCAAGTATATGACTGAAGAAGG + Exonic
1063773290 10:9229149-9229171 ATGTTGCATGTGAGCTAAGAGGG + Intergenic
1068163642 10:53300171-53300193 TTTTTGTATGTGATTTAAGATGG + Intergenic
1069130833 10:64700213-64700235 ATGTAATATGTGAGACAAGATGG + Intergenic
1072489117 10:95886490-95886512 AAGTAGTATTTGACCTAAAATGG + Intronic
1073502055 10:103948849-103948871 AAATAGTATGTCACTTAACATGG - Intergenic
1073807980 10:107120793-107120815 ATGTAGTATGGGAATTAAATGGG - Intronic
1074071193 10:110071631-110071653 ATGTAGTCTGTGTCTTCACAAGG + Intronic
1074932357 10:118141595-118141617 ATGTAGTAAGTGCCTTGATAAGG - Intergenic
1075769531 10:124921553-124921575 ATGTAGTAGGTAAGTCAAGATGG - Intergenic
1077965964 11:7133897-7133919 ATGTGAAATGTGACTCAAGATGG - Intergenic
1082894333 11:58174012-58174034 ATTTTGTATGTGATTTGAGAGGG + Intronic
1083080336 11:60085975-60085997 ATCTAGTATGTAACTTAAAGAGG + Intergenic
1084510845 11:69602684-69602706 ATGTGGTATGTATATTAAGAGGG - Intergenic
1086332171 11:85765062-85765084 ATGTAGTGGGTGGCTTAAGTTGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088291345 11:108241612-108241634 ATGTAGTATGTGACTGTGGTTGG + Intronic
1088396430 11:109374955-109374977 TTGTAGTACGTTTCTTAAGAAGG - Intergenic
1090986739 11:131773733-131773755 AGACAGTATGTGACTTTAGATGG - Intronic
1093133230 12:15417224-15417246 ATGTATTTTTTGACTTATGATGG - Intronic
1094224410 12:28029120-28029142 ATGTAGTATTTCACCTAACAGGG + Intergenic
1095362074 12:41354425-41354447 ATTCAGTATGGGACTGAAGAGGG - Intronic
1095506219 12:42901878-42901900 AGGTAGTATCTGACTCAGGAAGG + Intergenic
1096335948 12:50756696-50756718 ATACAGTCTGTGACTTATGATGG + Intergenic
1096398584 12:51286604-51286626 ATGTATTATATGATTTTAGATGG - Intronic
1098570882 12:71986035-71986057 AGGTACTTTGTCACTTAAGAAGG - Intronic
1098573415 12:72014279-72014301 ATGTAAAATGTAAATTAAGAGGG - Intronic
1099601879 12:84749907-84749929 GTGTAGTATGGGGCTTAATATGG - Intergenic
1101062987 12:100990686-100990708 ATGATGGGTGTGACTTAAGAGGG + Intronic
1109147416 13:58797653-58797675 ATGGAGGTTGTGACTTAAGAAGG + Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1111698331 13:91654039-91654061 ATCTCTAATGTGACTTAAGAAGG + Intronic
1111899801 13:94186888-94186910 CTGTAGTATGGAACTTACGAAGG + Intronic
1113038507 13:106078247-106078269 CTGTAGAATGTGCCTTAGGATGG - Intergenic
1114791870 14:25668646-25668668 AGGAAGCAAGTGACTTAAGAGGG - Intergenic
1114810015 14:25887759-25887781 CTGTAGTAAGTGACATAATAAGG + Intergenic
1114817143 14:25972995-25973017 ATGTAGTCTGTGAATAAAGGTGG - Intergenic
1116712951 14:48392176-48392198 ATTTAATATGTGTCTTAATATGG - Intergenic
1118035075 14:61857787-61857809 ATGGAGGATTTGACCTAAGATGG + Intergenic
1118140978 14:63082147-63082169 AAATAATATGTGACTTAAAATGG + Intronic
1119966582 14:78923046-78923068 ATGTAGTATGTGACTTTCTAGGG + Intronic
1122254237 14:100464928-100464950 ATGGAGTAGGGGACTTGAGATGG - Intronic
1128333204 15:66769811-66769833 ATGAAGTATGTGCCCAAAGAAGG + Intronic
1133375439 16:5283077-5283099 ACGTAGGCTGTGACTTCAGAGGG + Intergenic
1136415097 16:30098122-30098144 ATGTAGAATCTGACTTAACTGGG - Intergenic
1143970125 17:10789365-10789387 CTGTTGCAGGTGACTTAAGACGG + Intergenic
1146947170 17:36881590-36881612 ATGTTGTCTGTGAATAAAGATGG - Intergenic
1147862508 17:43531970-43531992 AGGTAGCTTGTGACTTAATAGGG - Intronic
1149291350 17:55220627-55220649 AGGTAGTGTATGAATTAAGATGG - Intergenic
1153732684 18:8030172-8030194 ATGGACTATGTGAATAAAGATGG - Intronic
1155226863 18:23736933-23736955 ATGCAGTCTGGGTCTTAAGAGGG - Intronic
1155235998 18:23819878-23819900 ATGAAGTATGAGATTGAAGACGG + Exonic
1155569946 18:27182576-27182598 ATGTATTATGTAACTTAATTTGG + Intronic
1161145958 19:2678229-2678251 ATGTAGCATGTGCCCTGAGATGG - Intronic
1164322606 19:24163396-24163418 ATGTAGGATGAGGCTTAAGATGG + Intergenic
1164426556 19:28146925-28146947 TTTTAGTTTGTGACTAAAGAGGG - Intergenic
1166526846 19:43516271-43516293 ATGTGGTCCTTGACTTAAGATGG + Intronic
928615911 2:33039446-33039468 ATGTAGTATAAGAGGTAAGAAGG - Intronic
929641946 2:43590344-43590366 ATTAAGCATGTGACCTAAGAAGG + Intronic
930402828 2:50912376-50912398 ATATTGCATGTGATTTAAGATGG + Intronic
930412031 2:51036805-51036827 AGGTAGAATGTGATTTAAAATGG + Intergenic
931566575 2:63621185-63621207 ATGTAGAAGGTGGCTTCAGACGG + Intronic
933479449 2:82837199-82837221 TTGTAGTAAGTGACTTAAGTAGG + Intergenic
938752536 2:134347150-134347172 ATGCAGGATGTGATTGAAGAAGG + Intronic
939312273 2:140496800-140496822 GAGTAGGATGTGAGTTAAGAAGG + Intronic
941145767 2:161843052-161843074 ATGTAGTATGAGGGTAAAGAAGG - Intronic
944468798 2:200031244-200031266 ATCTTGTATGTGGATTAAGAAGG + Intergenic
945579477 2:211574866-211574888 CTTTAATATGTGACTTCAGAGGG - Intronic
946347725 2:219124665-219124687 ATCTAGGATGTGTCTTAAGTTGG - Intronic
947755446 2:232560444-232560466 GTTTAGTGTGTTACTTAAGAAGG - Intronic
1170414142 20:16122165-16122187 ATGAAGTAGGTGACCTCAGAGGG + Intergenic
1170563886 20:17582688-17582710 ATGTTGTATTTAACTTAAAATGG + Intronic
1172073217 20:32274186-32274208 AAGTAGTAACTGACTTAACAGGG + Intergenic
1172541608 20:35721988-35722010 ATGTAGTATCTGACTTACGTAGG - Intronic
1174386275 20:50190221-50190243 ATATTGTCTGTGGCTTAAGAGGG + Intergenic
1181756826 22:25029787-25029809 ATGTAGTGTGTGAGTGAAGTGGG + Intronic
951258610 3:20480872-20480894 ATGGAGTATGTGCTTTTAGAAGG + Intergenic
952648602 3:35694143-35694165 CTATAGAATGTGACTTGAGAAGG + Intronic
952971081 3:38650610-38650632 AGGTTGTATGTGGCTCAAGAGGG - Intergenic
953369891 3:42378439-42378461 CTTTAGTAAGTGACTCAAGAAGG - Intergenic
955013471 3:55044527-55044549 ATATCGTATGTGCATTAAGATGG + Intronic
959365299 3:105450818-105450840 AAGTAGTATGTAAATTTAGAAGG + Intronic
960584997 3:119312514-119312536 ATGCAGGATGTGATTTAATAAGG + Intronic
962211160 3:133479385-133479407 ATTTAGTATGTGAATTGAGATGG - Intergenic
963087470 3:141451665-141451687 TTGTAGTATGGGACTTTAGTTGG - Intergenic
963261380 3:143194760-143194782 ATGTAGTTTGTGATTTGAGTCGG + Intergenic
963774573 3:149425387-149425409 GTGTAGAATGGAACTTAAGAGGG - Intergenic
965669597 3:171133473-171133495 GTGTAGTATGTAACTTTAAATGG + Intronic
966458595 3:180147507-180147529 ATGCTATATGTGACTTAGGAGGG - Intergenic
967633264 3:191771908-191771930 TTGTAGTATATGGCTTAAGTTGG - Intergenic
968142080 3:196266550-196266572 AAGTAGTATGTGATATATGATGG + Intronic
968409856 4:380808-380830 ATGTATTTTGTGTCTGAAGAGGG - Intronic
970636467 4:18015271-18015293 ATGTAGTATGTGCACAAAGAGGG + Intronic
972015845 4:34244451-34244473 TTATAGTATCTAACTTAAGAAGG + Intergenic
972810978 4:42585504-42585526 ATCTAGTATGTGTCTTCACATGG - Intronic
973127554 4:46606519-46606541 AAGGAATAGGTGACTTAAGAGGG + Intergenic
973535139 4:51873415-51873437 TTGTAGTTTATAACTTAAGACGG + Intronic
973676921 4:53273405-53273427 ATATAGCATGTGTCTTAAAATGG - Intronic
974109030 4:57505126-57505148 GTTAATTATGTGACTTAAGATGG - Intergenic
974357405 4:60831082-60831104 ATGTTATATTTAACTTAAGATGG - Intergenic
975071909 4:70151478-70151500 ACCTAGTATATGACCTAAGAAGG + Intronic
977512718 4:97981527-97981549 ATGTATTATGTGCCTTACTAAGG + Intronic
980666678 4:135948649-135948671 ATGTAGTATGTTACTAAATTTGG - Intergenic
981539049 4:145829472-145829494 ATATATTATGTGACCTAACAGGG + Intronic
982044545 4:151430199-151430221 ATGAAGTGAATGACTTAAGAAGG - Intronic
984416624 4:179468676-179468698 ATGTAGACTGTGATTTGAGAAGG + Intergenic
984449834 4:179885750-179885772 ATGTAGCATGTGATTTGATATGG + Intergenic
984502333 4:180571839-180571861 ATGTAGTTTTTGACTTGAGATGG - Intergenic
986267792 5:6205205-6205227 ATGTAGTAGGTGACATGAGCAGG + Intergenic
986942058 5:12965745-12965767 ATGTAGTAAGTGGCTCAAAATGG + Intergenic
989251577 5:39322027-39322049 ATGTATTATGTTACTTTGGATGG - Intronic
989630571 5:43477976-43477998 ATGTAATTTTTGACTTACGATGG + Intronic
989668773 5:43889370-43889392 AGGGAGAATGTGACTTATGAAGG + Intergenic
990384937 5:55251368-55251390 ATACAGTCTCTGACTTAAGATGG - Intergenic
991502608 5:67292004-67292026 ATGTAGAATGGGCATTAAGATGG - Intergenic
993691934 5:91012513-91012535 ATGTGGTAAGTGTCATAAGATGG - Intronic
993830087 5:92745463-92745485 ATGTGGTATGTGACTTCCCAAGG + Intergenic
994122095 5:96126446-96126468 ATATAGTATGAGTCCTAAGATGG - Intergenic
994179740 5:96751160-96751182 ATGAAGTATGATATTTAAGAAGG + Intronic
994376599 5:99022017-99022039 ATTTAGTATGCTACTTAAGAGGG - Intergenic
995639045 5:114232343-114232365 AAGTACTATATGATTTAAGATGG - Intergenic
996159065 5:120139993-120140015 TTGTAGCATGTCACTTAAAAAGG + Intergenic
997169125 5:131697630-131697652 ATGATGTAAGTGACTTAAGTTGG + Intronic
997896534 5:137723069-137723091 CTTTAATATGTGACCTAAGATGG - Intronic
1001845432 5:174917492-174917514 GTGAAGTATGTGACTCAAGGCGG + Intergenic
1002770257 6:284254-284276 ATGGAGGAGGAGACTTAAGAGGG + Intergenic
1004720255 6:18262845-18262867 AAGTGGTATGTGCCCTAAGAAGG - Intronic
1005146878 6:22701702-22701724 ATGCAGTATGTGTGTTAGGAAGG + Intergenic
1005664770 6:28041297-28041319 ATTTAGTATGGAACTCAAGAAGG + Intergenic
1011615189 6:89191765-89191787 GTGTGGTTTGTGACTTAAGAGGG - Intronic
1012417896 6:99029755-99029777 ATGAAGTAAGAGACTTAATAGGG + Intergenic
1013813145 6:114066988-114067010 CTGGAGTGAGTGACTTAAGAGGG - Intronic
1014276056 6:119390579-119390601 ATGTGGTTTGTGACTAATGATGG - Intergenic
1021014698 7:15518159-15518181 ATGTAGTAAGTGCCTTACTAGGG - Intronic
1021361372 7:19716903-19716925 ATGTATTGTGTGGCTGAAGAAGG + Intergenic
1021403581 7:20238011-20238033 ATGCAGTATTTGACTTAATGTGG + Intergenic
1021597352 7:22331391-22331413 ACGTAATATCAGACTTAAGAGGG - Intronic
1023316522 7:38943327-38943349 CTTTAGTATGTGAAATAAGATGG - Intergenic
1024824477 7:53375006-53375028 ATTAAATATGTCACTTAAGAGGG - Intergenic
1031938262 7:127759189-127759211 ATGTAGTATGTGACTTAAGATGG + Intronic
1034658279 7:152746680-152746702 ATGTAGGAAGTGACTTCACAGGG - Intergenic
1035795559 8:2353521-2353543 CTGTAGTATGTGATTTAATTAGG - Intergenic
1037204450 8:16297755-16297777 ATGTAGAGTGTGATTTAATAGGG + Intronic
1041443333 8:57923042-57923064 ATGTAGTCAGTGACTTAATTTGG - Intergenic
1044934540 8:97280166-97280188 ATTTAATATTTGACTTAAAAGGG + Intergenic
1045126352 8:99094133-99094155 ATACAGTATGTGATTTCAGATGG + Intronic
1045688341 8:104734846-104734868 ATGTGGTATGTGTCATAAAAGGG + Intronic
1047276482 8:123409344-123409366 ATGTACTATGTGAACTCAGAGGG - Intronic
1051041441 9:12817226-12817248 CAGTAATATGTGACTTGAGAGGG - Intronic
1055957099 9:81784566-81784588 ATGTAGTAGGGGACATAAAAGGG + Intergenic
1056249773 9:84735613-84735635 ATTCAATATGTGGCTTAAGAAGG + Intronic
1056551137 9:87653387-87653409 ATGTAAAATGCAACTTAAGATGG - Intronic
1059663271 9:116422401-116422423 ACTTAGTTTTTGACTTAAGATGG + Intergenic
1061535651 9:131247913-131247935 AACTAGTAAGTGACTTAAGAAGG + Intergenic
1186518971 X:10188734-10188756 ATGTAGTAAGTGGTCTAAGAAGG + Intronic
1186885454 X:13908950-13908972 ATGTAGTACTTGGCTTAAGTGGG - Intronic
1187659750 X:21529911-21529933 ATATAGTATGTGTATTAATAGGG + Intronic
1189848223 X:45155890-45155912 ATGCAGTATGTGCGTTAAAATGG - Intronic
1201718749 Y:17074683-17074705 TTGCTGTATGTGACTTAATAAGG - Intergenic