ID: 1031938669

View in Genome Browser
Species Human (GRCh38)
Location 7:127763845-127763867
Sequence GTATTTGGGGAGACTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031938662_1031938669 12 Left 1031938662 7:127763810-127763832 CCAGGCAGACATGGTGGCTAATG 0: 1
1: 0
2: 26
3: 309
4: 1193
Right 1031938669 7:127763845-127763867 GTATTTGGGGAGACTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031938669 Original CRISPR GTATTTGGGGAGACTGAGGG AGG Intronic
No off target data available for this crispr