ID: 1031940105

View in Genome Browser
Species Human (GRCh38)
Location 7:127779549-127779571
Sequence CTGTTTGCTCCGATTTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031940103_1031940105 7 Left 1031940103 7:127779519-127779541 CCAAACATTTCTTATAATGGCCT 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1031940105 7:127779549-127779571 CTGTTTGCTCCGATTTAGAATGG No data
1031940099_1031940105 28 Left 1031940099 7:127779498-127779520 CCCATGGTGTGGCCTAAGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1031940105 7:127779549-127779571 CTGTTTGCTCCGATTTAGAATGG No data
1031940100_1031940105 27 Left 1031940100 7:127779499-127779521 CCATGGTGTGGCCTAAGCTTCCA 0: 1
1: 0
2: 1
3: 16
4: 120
Right 1031940105 7:127779549-127779571 CTGTTTGCTCCGATTTAGAATGG No data
1031940101_1031940105 16 Left 1031940101 7:127779510-127779532 CCTAAGCTTCCAAACATTTCTTA 0: 1
1: 0
2: 1
3: 30
4: 320
Right 1031940105 7:127779549-127779571 CTGTTTGCTCCGATTTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031940105 Original CRISPR CTGTTTGCTCCGATTTAGAA TGG Intronic
No off target data available for this crispr