ID: 1031940627

View in Genome Browser
Species Human (GRCh38)
Location 7:127785150-127785172
Sequence CTGTGGGAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031940627_1031940633 -8 Left 1031940627 7:127785150-127785172 CCTTCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1031940633 7:127785165-127785187 TCCCACAGTGCTGGGATTATAGG 0: 278
1: 31198
2: 327055
3: 249294
4: 135373
1031940627_1031940636 11 Left 1031940627 7:127785150-127785172 CCTTCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1031940636 7:127785184-127785206 TAGGAGTAAGCCACCATGCCCGG 0: 7
1: 180
2: 3278
3: 26260
4: 88507
1031940627_1031940637 16 Left 1031940627 7:127785150-127785172 CCTTCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1031940637 7:127785189-127785211 GTAAGCCACCATGCCCGGCCAGG 0: 18
1: 352
2: 2287
3: 6409
4: 10027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031940627 Original CRISPR CTGTGGGAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr