ID: 1031943596

View in Genome Browser
Species Human (GRCh38)
Location 7:127815493-127815515
Sequence AAGAAGAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031943587_1031943596 22 Left 1031943587 7:127815448-127815470 CCACTGGACTCTAGTCTGTGCAA 0: 1
1: 3
2: 428
3: 10489
4: 101582
Right 1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG 0: 36
1: 155
2: 521
3: 2021
4: 6837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031943596 Original CRISPR AAGAAGAAGGAGGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr