ID: 1031944942

View in Genome Browser
Species Human (GRCh38)
Location 7:127830071-127830093
Sequence CTGTGGTTGCTGAATCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031944942 Original CRISPR CTGTGGTTGCTGAATCAAGA AGG Intronic
900732705 1:4272638-4272660 CTGTAGTTCCTGCATCCAGAGGG + Intergenic
901354634 1:8634070-8634092 CTTTGCTTGCTGAATGAAAAGGG - Intronic
904409235 1:30314948-30314970 CTGTGGCGGCTCACTCAAGATGG + Intergenic
905619640 1:39432563-39432585 CTTGGGTTGCTGAAACAAAACGG + Exonic
906065594 1:42978223-42978245 CTGTCCTTGCTGGATCCAGAGGG - Intergenic
908786190 1:67736708-67736730 CTGAGGTTCCTGGATCCAGACGG - Intronic
909444724 1:75735775-75735797 CAGAGGTTGCTGAGTAAAGATGG + Intronic
910742672 1:90537439-90537461 GTGTGGTTGCTGAATGAAGCAGG - Intergenic
912797003 1:112699494-112699516 CTGTGGAAGCTGAAACATGAAGG - Intronic
916266431 1:162894425-162894447 GAGTGGTTGTTTAATCAAGAAGG - Intergenic
916670489 1:167014262-167014284 CTGGGGTTTCTGGTTCAAGATGG - Intronic
918443168 1:184588971-184588993 CTGTGGTTGCTAAGTAAGGAAGG - Intronic
919278858 1:195459805-195459827 CTGTTGTTGCAGAAGCAACAGGG + Intergenic
920798429 1:209163186-209163208 CTGGGGTTGCTAGAGCAAGAAGG - Intergenic
921119104 1:212121186-212121208 CTGTCGTTGATTAATCAAGAGGG + Intergenic
921221618 1:212977905-212977927 CTGTGTTTGATGAATCAGAATGG + Intronic
921363756 1:214354613-214354635 CTGTGGTCCCTGAATCATGGGGG - Exonic
924075059 1:240325036-240325058 CTGTGGTTGTAGAATGAAAAGGG + Intronic
1063607734 10:7537563-7537585 TTGTAGTTGTTAAATCAAGAGGG + Intergenic
1066230378 10:33426221-33426243 CTGGGGTTGGTGAATCACGTTGG + Intergenic
1068559877 10:58502243-58502265 CTGTTGTTGCTGAAACAATCTGG - Intergenic
1069753591 10:70760448-70760470 CTGTGTGTCCTGCATCAAGAAGG + Exonic
1069765008 10:70849677-70849699 CCGTGGTTGTTGAGTGAAGAGGG + Intronic
1070801227 10:79245451-79245473 CAGTGGCTGCTGAATGATGATGG + Intronic
1071044391 10:81355971-81355993 CTGTGGTGGCTGAGTTGAGAGGG - Intergenic
1074262913 10:111871639-111871661 CTGTGAATGCTGAATCAGCATGG + Intergenic
1075119542 10:119654564-119654586 CTGTCATTGCTGAAGCAGGACGG + Intronic
1076383605 10:130041211-130041233 CTCTGGTTCCTGAGTCCAGATGG + Intergenic
1077092695 11:786893-786915 CTGTGGGTCCTGACCCAAGATGG - Intergenic
1079207167 11:18426121-18426143 CTTAGGAAGCTGAATCAAGAGGG - Intronic
1079314050 11:19392539-19392561 ATGTGGTTGCTGGATCCAGGAGG + Intronic
1079424346 11:20326028-20326050 CTGTGGTCAGTGATTCAAGATGG + Intergenic
1081118768 11:39237855-39237877 CTGTAGTGGCTGAATCCATAAGG - Intergenic
1084458327 11:69281936-69281958 GTGTGGTAGCTGACTCAAAATGG + Intergenic
1084911368 11:72392099-72392121 CTGGAGTTGGTGAAGCAAGAAGG + Intronic
1085471971 11:76764243-76764265 CCTTGGTTGCTGAATCATGGTGG - Intergenic
1085959817 11:81448241-81448263 CAGTGGTTGCAACATCAAGAGGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1091893684 12:4083365-4083387 CTGGGGATGCCAAATCAAGACGG - Intergenic
1093078916 12:14787356-14787378 CTTGGGTCGCTGAATCAAGTTGG + Exonic
1096561156 12:52436869-52436891 CTGTTGTTTCTGAAGCTAGACGG + Intergenic
1098810806 12:75088532-75088554 CTATGGTTGCTCTATCTAGATGG - Intronic
1100161667 12:91867777-91867799 CAGTGGTTCTAGAATCAAGAAGG - Intergenic
1101455488 12:104826438-104826460 CTGTGTTTGCTGTCTCAGGAAGG + Intronic
1101958338 12:109229883-109229905 CTTTGGGTCCTGAAACAAGATGG - Intronic
1102008767 12:109605556-109605578 CTGAGGGTGCTGGGTCAAGATGG + Intergenic
1106079494 13:26488376-26488398 GTGTGAATGCTGAAGCAAGAGGG - Intergenic
1112295169 13:98179964-98179986 CTGTGGAGGCTGAATCTAGGAGG - Intronic
1113818533 13:113193811-113193833 AATTGCTTGCTGAATCAAGAGGG + Intronic
1114341365 14:21748609-21748631 CTGTGAGTGCTGAAACAGGATGG + Intergenic
1115445653 14:33486358-33486380 TAGTGGTTGCTGAAAAAAGAAGG - Intronic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1119109804 14:71960880-71960902 ATGTGGTTGCTCAATTATGATGG - Intronic
1120543586 14:85781953-85781975 CAGTGATAGCTAAATCAAGATGG - Intergenic
1122104059 14:99437954-99437976 CTGTGGTTTCTGGAACCAGAAGG - Intronic
1127824656 15:62692304-62692326 CTGTGGCTGCTGCAGCAAAAGGG + Intronic
1127866758 15:63039807-63039829 CCGTGGCTGCTGAAACAAAAAGG - Intergenic
1130788445 15:87125651-87125673 CTGTGGCTCCTGAATCCAGAAGG - Intergenic
1132424574 15:101704113-101704135 CTGTGGTTTTTGAATCTAGAGGG - Intronic
1132930998 16:2459242-2459264 CTGGGGTTGCTGTTTAAAGATGG - Intergenic
1134292640 16:12914822-12914844 CTGTAGTTTCTGACTCAGGAGGG + Intronic
1135229793 16:20695168-20695190 CTGTGGTAGCTGAAACAGCATGG + Intronic
1135338562 16:21626690-21626712 ATCAGGTTGCTGAATCACGAAGG - Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1140053455 16:71503536-71503558 AGGTGGCTGCTGAATCAAGTTGG - Intronic
1143089599 17:4441515-4441537 TTGTGGGTGTTGAACCAAGATGG - Intronic
1143697874 17:8633417-8633439 CTGTGCTTTCTTCATCAAGATGG - Intergenic
1144596310 17:16572963-16572985 CTGAGGATGCTGGATCAAGAAGG + Intergenic
1151387078 17:73761447-73761469 CAGTGGGTGCTGTGTCAAGATGG + Intergenic
1154378044 18:13825041-13825063 CTGTGGAGGCTGAATCCTGATGG + Intronic
1158293202 18:55965151-55965173 ATGTGGTTGCTCACTTAAGAAGG + Intergenic
1158753319 18:60291709-60291731 CTATGGTTGCTGACTGAAAAAGG - Intergenic
1159952060 18:74491865-74491887 CTCTGCTTGCAGAATAAAGAGGG + Intergenic
1163739633 19:19003515-19003537 CAGTGGTTGCTGAATCGGGCAGG + Intronic
1165441624 19:35831567-35831589 CTGTGGTTGCTGCATACTGAAGG - Intronic
925985640 2:9212760-9212782 CGGTGGTTGCTGAGCCAATATGG - Intronic
926525535 2:13975184-13975206 CTGTGTTTTGTGGATCAAGAGGG - Intergenic
926603917 2:14877322-14877344 CCGAAGTTGCTGAATCAAGGGGG - Intergenic
929582151 2:43088309-43088331 CTGGGCTGGCTGAGTCAAGATGG + Intergenic
932177703 2:69617962-69617984 CAGAGGTTGCTGAATGATGAAGG - Intronic
936865914 2:117076664-117076686 CTATGGGGACTGAATCAAGAGGG + Intergenic
937385747 2:121430651-121430673 CTGTGATGGCTGAGTTAAGAAGG - Intronic
937424530 2:121787719-121787741 GTGTGGGAGCTGAACCAAGAAGG - Intergenic
939037987 2:137155995-137156017 CTGTGCTTGCTGAATGAACTTGG + Intronic
940397137 2:153202317-153202339 GAGAGGTTGCTGAATGAAGAAGG - Intergenic
940906916 2:159178100-159178122 CAGTGTTTGCTGCATAAAGAAGG + Intronic
943099964 2:183475695-183475717 CTGTGGGTGCAGAATCATGGAGG - Intergenic
946555837 2:220856136-220856158 CTGTGTCTGCTGAGTCCAGAAGG + Intergenic
946980382 2:225207196-225207218 CTGTGGATGCAAAATCCAGATGG + Intergenic
1170075822 20:12417683-12417705 CTGGGGCTGCAGAAACAAGAAGG - Intergenic
1170957823 20:20997549-20997571 CTGAGGTTGCTGTAGCAGGAAGG - Intergenic
1171431868 20:25087964-25087986 CTGTGGCTGTGGAATAAAGATGG - Intergenic
1184300567 22:43556304-43556326 CTGTGGCTGCTGCATCAACAGGG + Intronic
1184410671 22:44324377-44324399 CTGTGGTTGTTGAATGAATGAGG - Intergenic
949564997 3:5236206-5236228 CTGTGGATGCTGAAGACAGAAGG + Intergenic
951144743 3:19213939-19213961 CTCTGGTTTCTGTGTCAAGAAGG - Intronic
952075847 3:29696766-29696788 CAGTGGTAGCTGAATTAATAAGG - Intronic
952962562 3:38601874-38601896 CTGTGGGTGCCTAATCAACAAGG - Intronic
954476196 3:50748307-50748329 CTGTGGTTTCTGAGTTTAGAGGG + Intronic
955543273 3:60000573-60000595 TTGTGGCTACTAAATCAAGAGGG + Intronic
956793479 3:72698305-72698327 CTGTGGTGGGTCAGTCAAGAAGG - Intergenic
958436180 3:94098609-94098631 ATGAGGTTGCTGAAGTAAGAAGG - Intronic
960341018 3:116474969-116474991 CTGTGGTTGCTGGTTCAAGGAGG - Intronic
961156041 3:124680625-124680647 TTGTGGTGGCTGAAACAACATGG - Intronic
962422847 3:135243326-135243348 CTGTGCTTGCTGATTCTAGAAGG + Intronic
963418592 3:145029938-145029960 CTGTGGTTGATAAATGAAAATGG - Intergenic
966598344 3:181748418-181748440 CTGTGGCTGGTTAATCAAGTTGG + Intergenic
967856872 3:194124642-194124664 CTCTGGCTGCTGAATCAAAGGGG - Intergenic
969340921 4:6540713-6540735 ATGTGGTTTCTGCATGAAGATGG + Intronic
970628369 4:17914843-17914865 GTGTGGCTGCTGCTTCAAGATGG + Intronic
972789301 4:42355528-42355550 CTGTGGTTGCTGACATTAGATGG + Intergenic
977416833 4:96743922-96743944 CTGTGGTTTCTGAGTCAAGAGGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
979611214 4:122690977-122690999 CAGTGGGAGCTGAATCAAAATGG - Intergenic
981014448 4:139959326-139959348 CCATGGATGCAGAATCAAGACGG - Intronic
982717341 4:158822740-158822762 CTTAGGTTGCTGAAGCAAAAAGG - Intronic
988340622 5:29966139-29966161 CTGTGGTTCCTGAATGTGGATGG - Intergenic
988592356 5:32560067-32560089 CTGTGGTTGCTGACCAAAAAAGG - Intronic
990165482 5:52989258-52989280 CGGTGTTTGCGGAATCAGGAGGG + Intergenic
991100466 5:62786463-62786485 ATTTAGTTGCTGATTCAAGAGGG - Intergenic
994450135 5:99930343-99930365 ATGTGGTGGCAGAATAAAGAGGG - Intergenic
996279541 5:121711832-121711854 TTGTTGTTGCAGTATCAAGATGG - Intergenic
997964408 5:138346007-138346029 CTGTGAGGGCTGAAGCAAGATGG + Intronic
999644654 5:153705788-153705810 CTGTGGTTTTTTAATCATGATGG - Exonic
1001758912 5:174191603-174191625 CTGAAGTTGCTGTATCAAGGAGG - Intronic
1002687341 5:181024095-181024117 CTGTGGATCCAGTATCAAGATGG - Intergenic
1004346907 6:14857302-14857324 CTGTTGTTGCTGAAGCACCAAGG + Intergenic
1004688129 6:17967747-17967769 CTCTGATTTCTGAACCAAGAAGG + Intronic
1006910848 6:37562685-37562707 CTGTGGTTGCTAAATCATCCTGG + Intergenic
1008627247 6:53329093-53329115 CAATGGCTGCTGAAGCAAGAAGG + Intronic
1008633020 6:53381889-53381911 CTTGGGTTGCCGAATCAAGGTGG - Intergenic
1009803700 6:68574804-68574826 CTGTGTTTGCTGAAATAAGCCGG + Intergenic
1010905346 6:81480042-81480064 CTGAGGGTGCTGAATCAAGGTGG - Intergenic
1011848931 6:91602152-91602174 TTTTGGTTCCTGAATAAAGAGGG - Intergenic
1012712011 6:102618404-102618426 CTTTGAGTGCTTAATCAAGAAGG + Intergenic
1013352537 6:109318602-109318624 CTGTGTTTGCTGCATCCAGGCGG + Intergenic
1013729129 6:113142280-113142302 CTGTGAATTCTAAATCAAGAAGG - Intergenic
1014335182 6:120124569-120124591 CTTTGGATACTAAATCAAGAAGG - Intergenic
1014901808 6:126974923-126974945 ATGTGCTTCATGAATCAAGATGG - Intergenic
1017021790 6:150145658-150145680 CTCTGGTTTGTGAATCAAGAAGG + Intronic
1017790469 6:157793678-157793700 CTGGGGTTGCTGAGGCAGGATGG - Intronic
1019639227 7:2094282-2094304 CTGTGGATTCTGCATCCAGAGGG - Intronic
1022325038 7:29323413-29323435 CTGTGGTAGCAGAATAATGAGGG - Intronic
1022793968 7:33717430-33717452 CTCTGGTTCTTGAATCAGGATGG + Intergenic
1022886676 7:34653858-34653880 CTGTGGTGCCTGCATCATGAAGG - Intergenic
1023261397 7:38362431-38362453 CTGCGGTTTCTGGATCATGATGG + Intergenic
1026185450 7:68079541-68079563 CTCTGGCTGCTGTAGCAAGAAGG + Intergenic
1026706831 7:72701369-72701391 CTGAGGATGCTGAGTCAGGAGGG - Intronic
1028830415 7:95321626-95321648 ATGTGGTTGCTTATTTAAGAGGG + Intronic
1031478933 7:122255278-122255300 CTGTGGCTGTTGAATACAGAAGG - Intergenic
1031944942 7:127830071-127830093 CTGTGGTTGCTGAATCAAGAAGG + Intronic
1034369490 7:150582618-150582640 CTGTTGTTTCTGAATCACGGAGG - Intergenic
1034620152 7:152450655-152450677 CTCTGGTTGCTAGATCAAGCTGG - Intergenic
1034676998 7:152899028-152899050 CTGTGGTTGAGGAATCTACAGGG - Intergenic
1038736871 8:30177988-30178010 CTGGGGTTCTTGAATCAAGAAGG - Intronic
1039176203 8:34809463-34809485 CTGCAGTTGCTGAATCAATTAGG - Intergenic
1040447852 8:47513968-47513990 CTGTGGTTGGTGACTCACCATGG + Intronic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1042473755 8:69221231-69221253 CTGTGGTTGCTCATTCTTGATGG - Intergenic
1045660136 8:104428679-104428701 TTGGGGATGCTGAATCATGAAGG + Intronic
1046497176 8:115030081-115030103 GTGTGAATGCTGAAGCAAGAGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049725495 8:144143791-144143813 GTGTGGCTGCTGCCTCAAGAGGG - Intergenic
1051038418 9:12776551-12776573 CTGCGGCTGCTGCACCAAGAAGG - Intronic
1051435761 9:17029752-17029774 CTGAAGTTGCAGAATTAAGAAGG + Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051921153 9:22266984-22267006 CTGTGGGTCCTGCTTCAAGATGG + Intergenic
1053595145 9:39553113-39553135 TTGTGGCTGGTGAATAAAGAAGG + Intergenic
1054571114 9:66811861-66811883 TTGTGGCTGGTGAATAAAGAAGG - Intergenic
1055170124 9:73247068-73247090 CAGTGTGTGCTGAATCAATAGGG + Intergenic
1056039171 9:82643455-82643477 GTGGGATTGCTGAATCAAGTGGG - Intergenic
1056247635 9:84712112-84712134 CAGTGGTTGCTGAACCAATGTGG - Intronic
1056782051 9:89557774-89557796 CTGTGGGAGCTGCAGCAAGAAGG - Intergenic
1062174635 9:135154355-135154377 CAGTGGTTGCTGGCTCAGGAGGG + Intergenic
1188940215 X:36229075-36229097 CTCTGCTTGTTGAAGCAAGAAGG - Intronic
1189230775 X:39450911-39450933 CTGAGGTTGCTGCATCATGGAGG - Intergenic
1189308134 X:40002684-40002706 GTGTGGGTTCTGAATCTAGAAGG + Intergenic
1190477068 X:50839091-50839113 CTGTAGTCGCTGGATCAAGTTGG + Intergenic
1193359353 X:80561744-80561766 TTTGGGTTGCTGAATCAAGTTGG - Intergenic
1195079628 X:101358616-101358638 CTGTGTTTGCTAAATCCACAGGG - Exonic
1198784630 X:140273763-140273785 CAGTGGTTGCTGAATAAAACAGG - Intergenic