ID: 1031945138

View in Genome Browser
Species Human (GRCh38)
Location 7:127831674-127831696
Sequence GTGATGAAACAGATGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031945136_1031945138 2 Left 1031945136 7:127831649-127831671 CCGTGGCCTCAGTGTGGGAACTA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1031945138 7:127831674-127831696 GTGATGAAACAGATGCTCAAAGG No data
1031945137_1031945138 -4 Left 1031945137 7:127831655-127831677 CCTCAGTGTGGGAACTATTGTGA 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1031945138 7:127831674-127831696 GTGATGAAACAGATGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031945138 Original CRISPR GTGATGAAACAGATGCTCAA AGG Intronic
No off target data available for this crispr