ID: 1031947658

View in Genome Browser
Species Human (GRCh38)
Location 7:127858258-127858280
Sequence CCCGGACCGGCTCTCCGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 16}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031947658_1031947667 3 Left 1031947658 7:127858258-127858280 CCAATTCGGAGAGCCGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 16
Right 1031947667 7:127858284-127858306 TGCGGGGAACTGGGTCACCCAGG 0: 1
1: 0
2: 1
3: 13
4: 123
1031947658_1031947665 -6 Left 1031947658 7:127858258-127858280 CCAATTCGGAGAGCCGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 16
Right 1031947665 7:127858275-127858297 TCCGGGCACTGCGGGGAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1031947658_1031947664 -7 Left 1031947658 7:127858258-127858280 CCAATTCGGAGAGCCGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 16
Right 1031947664 7:127858274-127858296 GTCCGGGCACTGCGGGGAACTGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031947658 Original CRISPR CCCGGACCGGCTCTCCGAAT TGG (reversed) Intronic
900198079 1:1387528-1387550 CCGGGAGCGGCTCTGCGACTTGG + Exonic
904241409 1:29148566-29148588 CCTGGACCGGGTCTCCTGATTGG + Exonic
907048698 1:51315466-51315488 CCCAGACCGGCTGTCAGGATAGG + Intronic
1083409112 11:62479770-62479792 CCAGAACCGGCTCTCCAAGTGGG + Intronic
1114838068 14:26227701-26227723 CCCTGACCCTCTCTCCTAATAGG - Intergenic
1136450839 16:30353560-30353582 CCTGGACCGGCTCTCCGGGTTGG - Exonic
1142637659 17:1268194-1268216 CCGGGACCCGCTCTCCGGAGGGG + Intergenic
1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG + Intergenic
1152554749 17:81047199-81047221 CCCGGTCCCTCTCTCCCAATTGG - Intronic
1164748162 19:30631109-30631131 TCCCGACCGGCTCTCTGGATTGG + Intronic
1167739032 19:51312753-51312775 CCCGGCCCGGCCCTCCCAGTTGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
1174573959 20:51523967-51523989 CCCTATCCGGCTCTCCGAATCGG + Exonic
989812450 5:45695431-45695453 CCCGGACGGGCTCTCCTCCTTGG - Intronic
998424223 5:142013121-142013143 CCCGGACCGACTCTCCCAGGTGG + Intergenic
1031947658 7:127858258-127858280 CCCGGACCGGCTCTCCGAATTGG - Intronic
1041211839 8:55559671-55559693 CCCCTCCCGGCTCACCGAATAGG - Intergenic
1044883610 8:96750784-96750806 CCCTGAACCGCTCTCCCAATAGG + Intronic
1049844224 8:144792272-144792294 CCCGGACCGGCCCTCCTGAGAGG - Intronic
1053345095 9:37372087-37372109 CCAGGACCTGCTCTCCCAAAGGG + Intergenic