ID: 1031949194

View in Genome Browser
Species Human (GRCh38)
Location 7:127874173-127874195
Sequence GTGTCTCTGCCCCACCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031949193_1031949194 14 Left 1031949193 7:127874136-127874158 CCACGCAGAAGCATTTAATAGGC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1031949194 7:127874173-127874195 GTGTCTCTGCCCCACCTGCCAGG 0: 1
1: 0
2: 5
3: 39
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031949194 Original CRISPR GTGTCTCTGCCCCACCTGCC AGG Intronic
900126931 1:1072871-1072893 TTGGCCCTGCCCCACCTGGCTGG + Intronic
900135907 1:1116820-1116842 GCGTCGCTGCCCCACAGGCCGGG + Intergenic
900140297 1:1136965-1136987 GGGCCTCTGGGCCACCTGCCTGG + Intergenic
900154784 1:1199538-1199560 TCGGCTCTGCCCCACATGCCTGG + Intergenic
900925945 1:5705985-5706007 GTGTGTCTGGCCCTCCAGCCCGG - Intergenic
903649843 1:24915853-24915875 GTGTCACCGCCCCTCCTGCTGGG + Intronic
904807506 1:33142223-33142245 CTGTCTCCTCCCCTCCTGCCTGG - Intergenic
905797288 1:40822900-40822922 GTGGGTCTGCCCCACTGGCCCGG + Intronic
906207927 1:43996917-43996939 GGGTCTCTGCCCCTCATTCCAGG - Intronic
906301820 1:44688015-44688037 GTGTCTCAACCCCACCTCCCTGG + Intronic
907357330 1:53886967-53886989 CTGTCTCTGCCCAAGCTGCATGG - Intronic
907458924 1:54593810-54593832 GAGTTTCTGCACCACCTACCAGG - Intronic
907592448 1:55688293-55688315 GTCTGTCTGCCCCATCTGCCTGG + Intergenic
908396327 1:63728779-63728801 GTGTCTCCGCCCCACCTCCCAGG - Intergenic
909591477 1:77353808-77353830 CTGCCTGTGTCCCACCTGCCAGG - Intronic
912475158 1:109930141-109930163 GCATCTCAGCCCCACCTGCATGG + Exonic
914854981 1:151344222-151344244 GTGTCTATGCCACCCCTGCCTGG - Exonic
915325626 1:155080134-155080156 GGGTCACTGTCACACCTGCCCGG + Intronic
916880874 1:169018567-169018589 TTGTCCCTGCCCCACCTTCCAGG - Intergenic
917647612 1:177044561-177044583 GCAGCTCTTCCCCACCTGCCAGG + Intronic
918083445 1:181224860-181224882 GTGTCACTGCCCATCCTGCTTGG - Intergenic
920712651 1:208309890-208309912 GTGTCTCTGCTTCCCCTTCCTGG - Intergenic
921775996 1:219100721-219100743 TTGTCTCTGCCTCAGCTTCCTGG - Intergenic
922620946 1:226987774-226987796 GTGTCACTGCCCCAGCCCCCGGG + Intergenic
922729479 1:227942299-227942321 CTCTCCCTGCCCCACCTGCTTGG - Intronic
1062902438 10:1156348-1156370 GTGGCTCTGCCCCCCCACCCAGG + Intergenic
1063477696 10:6343277-6343299 GTGTCTCTGCCCCAGGAGGCAGG - Intergenic
1063985219 10:11494713-11494735 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1064093717 10:12407229-12407251 GCGGCTCTGCCCGCCCTGCCAGG - Intronic
1064350179 10:14568842-14568864 CTGTCTCTCCCCCTCCTTCCAGG - Intronic
1064899171 10:20275155-20275177 GTGTCTCTGGCACACCTTCATGG - Intronic
1067077895 10:43198418-43198440 GTGTCACTGCCCTGCCTGCCAGG + Intronic
1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG + Intergenic
1067755043 10:48998980-48999002 GTGCCCCTGCCCCAGCTGCTGGG - Intergenic
1067910456 10:50341299-50341321 GTGTATCTGGCCCACCAGACAGG - Intronic
1069566232 10:69465166-69465188 GTGTCTCTGCCACAGCCTCCTGG - Intronic
1069870853 10:71532082-71532104 GAGTCTCAGCCCCTCCTTCCTGG - Intronic
1069879242 10:71581398-71581420 GTCTGTCTGCCCCACGTGGCTGG + Intronic
1070386981 10:75934616-75934638 GTCTCTCTTCCCCACTAGCCAGG - Intronic
1071028096 10:81139764-81139786 GTGTGTCTGCCCTGCCTGCTAGG - Intergenic
1073106129 10:101032983-101033005 GTGTCTGTGCCAGCCCTGCCTGG + Intronic
1073834568 10:107426220-107426242 GTGTCAGTGCCTCACCTGCACGG - Intergenic
1075093474 10:119456308-119456330 TTGCCTCTGCCCCACCTTCCTGG - Intronic
1076497302 10:130905501-130905523 GAGCCTCTGCCCCTACTGCCTGG + Intergenic
1076550746 10:131276707-131276729 TTTTCTCTACACCACCTGCCAGG + Intronic
1076585041 10:131541307-131541329 GTGCCTCTTCCCCTTCTGCCAGG - Intergenic
1076601359 10:131658904-131658926 GTGCCTGTGCCCCTCCTGTCAGG - Intergenic
1076628752 10:131839894-131839916 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1077065303 11:638343-638365 TGGTCTCTGCCCCAGCCGCCTGG - Intronic
1077183361 11:1226148-1226170 GTGTCTCTGCTTCCCCTTCCTGG + Intronic
1077474236 11:2778867-2778889 CTGTGCCTGCCCCGCCTGCCCGG - Intronic
1077873288 11:6281376-6281398 TTGTCTCTGTTCCATCTGCCTGG - Intergenic
1079110948 11:17604932-17604954 GTGTCCCTGTCACACCTCCCTGG - Intronic
1079882392 11:25944039-25944061 GTGTGTCTGCTCCCACTGCCTGG - Intergenic
1081588960 11:44407635-44407657 GTGTCTGTCCCTGACCTGCCTGG - Intergenic
1081906464 11:46673507-46673529 GTGTGTGTCCCCCAACTGCCTGG + Intronic
1082002123 11:47398917-47398939 GTGTCTCAGCCCCACCATGCAGG - Intergenic
1082810194 11:57474902-57474924 GAGGCGCTGTCCCACCTGCCTGG - Intronic
1083349439 11:62017002-62017024 CTCTCTCTGCCTCAGCTGCCAGG + Intergenic
1084116422 11:67045305-67045327 GTGTCCTTGCCGCACCTGCCTGG - Intronic
1084180182 11:67442198-67442220 GTGACTGTGCCCCACTTGCCAGG + Intronic
1084327067 11:68406594-68406616 GTGTGGCTGCCCCATCGGCCTGG + Exonic
1084658263 11:70531890-70531912 TTGTCTCTGCCAAACCTTCCCGG + Intronic
1085033051 11:73284172-73284194 CTGTCACTGCCCCACTTGGCTGG - Intronic
1092224947 12:6742227-6742249 CTCTCTCTGCCTCAGCTGCCAGG + Intergenic
1094417918 12:30236728-30236750 CTGACTCTGCCCCTCCTTCCTGG - Intergenic
1096181274 12:49551859-49551881 GTGACACCGCCCCACCTTCCTGG - Intronic
1096555974 12:52404075-52404097 GTGTCTGTGTCTCCCCTGCCTGG + Intronic
1097591680 12:61582462-61582484 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1098384802 12:69907480-69907502 TTGTTCCTGCCCCACCTGCAGGG - Intronic
1098935346 12:76472650-76472672 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1100231378 12:92611730-92611752 CTGGCTCTGCCCCACTTGCTGGG + Intergenic
1101816603 12:108150721-108150743 CTCTCTCTGCCCACCCTGCCCGG + Intronic
1102830612 12:115995547-115995569 GTGTCTGTGACCCAGCTGCTTGG - Intronic
1102953787 12:117046666-117046688 TTGTTTCCGCCCCACCTGGCAGG - Exonic
1103290476 12:119841737-119841759 ATGTCTCTGTTCCAGCTGCCTGG - Intronic
1103415737 12:120740602-120740624 GACTCTCTGCCCTGCCTGCCCGG - Intergenic
1103902625 12:124311337-124311359 GTGTCTGTGGCACACCTGCCAGG - Intronic
1104583798 12:130030833-130030855 GTGTCTCTTCCCCCACTCCCAGG - Intergenic
1104715747 12:131015203-131015225 GTGTTTCTGCCCCACCTGGGAGG + Intronic
1104748695 12:131224873-131224895 CTGGCTCTGCCCCTCCAGCCTGG - Intergenic
1104784429 12:131440691-131440713 CTGGCTCTGCCCCTCCAGCCTGG + Intergenic
1104932469 12:132347097-132347119 GTGGCTCTGCTGCCCCTGCCTGG + Intergenic
1104980875 12:132572634-132572656 CTGTGCCCGCCCCACCTGCCAGG - Intronic
1104991400 12:132625728-132625750 GTGGCTCTGCTCCAACTGTCAGG - Exonic
1106458673 13:29949229-29949251 GTGTCTCTGCCCAGCCAACCAGG + Intergenic
1107556639 13:41521313-41521335 ATGTCTCTGCTTCACCAGCCAGG - Intergenic
1108322943 13:49304563-49304585 GTGCCTCTGCCCCCCATCCCGGG + Intergenic
1110626845 13:77662403-77662425 GGGTCGCTGTCCCACCTGACTGG + Intergenic
1111903670 13:94230487-94230509 GTGTCTCTGGCACACGTGTCAGG - Intronic
1112330452 13:98473583-98473605 GTGTCTCTACCCCACGTGGGAGG - Intronic
1113450297 13:110404635-110404657 GTTTCTCAGACCCACCTCCCTGG - Intronic
1113758719 13:112832889-112832911 CTGTCTCTGCCACACCGTCCAGG + Exonic
1113930272 13:113964651-113964673 GTGTCTCCTACCCACCAGCCAGG - Intergenic
1114547495 14:23513357-23513379 GTGTGTCTGCCACCGCTGCCTGG + Intergenic
1117457279 14:55911056-55911078 CTGCCTCTGCCCCATCTCCCAGG - Intergenic
1117632563 14:57708887-57708909 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1118256352 14:64209266-64209288 TTGTCTGTGCTCCTCCTGCCTGG - Intronic
1119506388 14:75176550-75176572 GTTTGTCTGGCCCACCAGCCCGG - Exonic
1119512467 14:75222232-75222254 TTGTCCCAGCCCCACCTGCGGGG + Intergenic
1121095910 14:91217901-91217923 GTTTCTCTCCAGCACCTGCCTGG + Intronic
1121307330 14:92915318-92915340 GTGCCATTGCCCCACCTGCATGG + Intergenic
1121439656 14:93940640-93940662 GTCTCTCTGCCTCACCTTCTGGG + Intronic
1121563959 14:94894843-94894865 GTGCCTCTGCCAGACCTGGCTGG + Intergenic
1121713426 14:96055860-96055882 GTGATTCTGCCCCACTTGGCAGG - Intronic
1121972818 14:98374485-98374507 GTGTCTCTGCCCTGTGTGCCAGG + Intergenic
1122271811 14:100571658-100571680 GTGACTCTGTGCCACCTGTCAGG + Intronic
1122814738 14:104306881-104306903 GGCTCACTGCCCCAGCTGCCAGG - Intergenic
1123193229 14:106591516-106591538 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1123459791 15:20459470-20459492 GTGGATCGGACCCACCTGCCAGG + Intergenic
1123658271 15:22540950-22540972 GTGGATCGGACCCACCTGCCAGG - Intergenic
1123711367 15:22990155-22990177 GTGTGCCTGCCCCACCTCTCGGG - Intronic
1123966494 15:25465148-25465170 TAGTCTCTCCCCCACGTGCCAGG + Intergenic
1124312136 15:28635442-28635464 GTGGATCGGACCCACCTGCCAGG - Intergenic
1127260366 15:57322947-57322969 GGGTCTCCGCCCCAGCTGCCTGG + Intergenic
1127950753 15:63803463-63803485 GTGTCGCTGCCACTCCAGCCTGG - Intronic
1128688079 15:69701982-69702004 GACTGTCTCCCCCACCTGCCTGG - Intergenic
1129574904 15:76732881-76732903 CTCTCTCTGCCTCAGCTGCCAGG + Intronic
1129741080 15:77989945-77989967 GTGTCCCTGCCCCCACTGCTAGG + Intronic
1129844639 15:78762607-78762629 GTGTCCCTGCCCCCACTGCTAGG - Intronic
1129923280 15:79339172-79339194 CTCTCTCTGCCTCAGCTGCCAGG + Intronic
1130037455 15:80374751-80374773 TCCTCTCTGCCCCACCTGCAAGG + Exonic
1130257188 15:82331259-82331281 GTGTCCCTGCCCCCACTGCTAGG + Intergenic
1130597764 15:85258731-85258753 GTGTCCCTGCCCCCACTGCTAGG - Intergenic
1131543997 15:93300372-93300394 GTGTCTCAGCCTCACCCACCTGG - Intergenic
1132856892 16:2049412-2049434 GTGTCTTTGTCACACATGCCTGG + Intronic
1133032573 16:3018242-3018264 GGGTCTCTGCCCCTCCTCCGGGG - Exonic
1133108175 16:3527808-3527830 GTCTCTCTGCCTCAGCTGCCAGG + Intronic
1134094605 16:11411223-11411245 GTAACTGTGCCCCAGCTGCCTGG - Intronic
1134230613 16:12426330-12426352 CTGTCTCTTACCCCCCTGCCAGG - Intronic
1135324854 16:21519870-21519892 GCCGCTCTTCCCCACCTGCCCGG - Intergenic
1135793450 16:25419886-25419908 GAGTATCTGCTCCAGCTGCCAGG - Intergenic
1136066852 16:27765214-27765236 GTGGCTCTGGCCCACGTGTCTGG - Intronic
1136704206 16:32172727-32172749 GTGGCTCGGACCCACCTGCCAGG + Intergenic
1136763703 16:32756679-32756701 GTGGCTCGGACCCACCTGCCAGG - Intergenic
1136804396 16:33113707-33113729 GTGGCTCGGACCCACCTGCCAGG + Intergenic
1137385866 16:48042042-48042064 CTGTCGCTGTCCCACCTGCAGGG - Intergenic
1138583873 16:57958227-57958249 CTGGCCCAGCCCCACCTGCCAGG - Intronic
1138591955 16:58005025-58005047 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1139573552 16:67827763-67827785 GTGACTCTGCCCAAGCTGCGAGG + Exonic
1139759153 16:69170423-69170445 TTGCCTCTGCCCCACCTGTTAGG + Intronic
1141293311 16:82741317-82741339 TTTTCTCTCTCCCACCTGCCTGG + Intronic
1141476886 16:84280042-84280064 GTGTGTGAGCCCCACATGCCCGG + Intergenic
1141495190 16:84404954-84404976 CTCTCTCTGCCCCATCTGCACGG + Intronic
1141660674 16:85439437-85439459 CTGTCTCTCCCCCTCCTGCTCGG - Intergenic
1141666568 16:85468692-85468714 ATGTCTCTCCCCTCCCTGCCTGG + Intergenic
1141714133 16:85717115-85717137 GTGGCTCTGCCCCCACTGCGAGG - Intronic
1142022964 16:87795518-87795540 ATCTCTCTGGCCCAGCTGCCGGG + Intergenic
1142037059 16:87868927-87868949 GCCGCTCTTCCCCACCTGCCCGG - Exonic
1142121388 16:88388240-88388262 CTGGCTCTGGCCCACCGGCCAGG - Intergenic
1203065853 16_KI270728v1_random:1017000-1017022 GTGGCTCGGACCCACCTGCCAGG - Intergenic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1143269035 17:5662019-5662041 GTGACTCTACCCCTCCTGCCTGG - Intergenic
1143731947 17:8886433-8886455 CCGCCTCTTCCCCACCTGCCGGG - Intronic
1143852054 17:9820421-9820443 GAGTCTCTTCCCCACCTTCATGG - Intronic
1143866429 17:9926894-9926916 GTGTCTCTCACCTTCCTGCCAGG - Intronic
1143889083 17:10088526-10088548 GTGGAACTGCCCCTCCTGCCCGG - Intronic
1144349315 17:14379325-14379347 GATTCTCTTCCCCACATGCCAGG + Intergenic
1144951036 17:18993562-18993584 GTATCTGTCCTCCACCTGCCTGG - Intronic
1145102338 17:20087582-20087604 CTGGCCCTGCCCCACCAGCCAGG - Intronic
1145223441 17:21107714-21107736 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1145982805 17:29023955-29023977 AGGCCCCTGCCCCACCTGCCTGG - Intronic
1146912770 17:36658925-36658947 GAGGCCCTGCCCCTCCTGCCAGG + Intergenic
1147142348 17:38466667-38466689 GTGGCCCTGCTCCACCTCCCAGG + Exonic
1147568979 17:41555741-41555763 GTGTCTGTGCTCCAGCTGCAAGG - Intergenic
1148090549 17:45020378-45020400 ATTTCTGTGCCCCACCTTCCAGG + Intergenic
1148462746 17:47847727-47847749 CTGTCGCTGCCCCAACTGTCTGG - Exonic
1148566595 17:48636598-48636620 CTGTCTCGGCCTCACCCGCCGGG - Intergenic
1148766650 17:50043571-50043593 AGGTCTCTGCCCCTTCTGCCGGG + Intergenic
1149470723 17:56913448-56913470 GTGCATCTGCCACATCTGCCTGG - Exonic
1151486799 17:74406079-74406101 CTGTCTCTTGCACACCTGCCGGG + Intergenic
1151518978 17:74615047-74615069 GTGTCTCTGCCCCTCCAACGGGG - Intronic
1152178588 17:78803597-78803619 CTGTGTCTGCCCCTCCTGCAGGG + Exonic
1152262981 17:79277218-79277240 CTGGTTCTGCCCCACCTGCCTGG + Intronic
1152589475 17:81204306-81204328 CCATCTCTGCCCCACCTGCAGGG - Intronic
1152835101 17:82524766-82524788 GTGTCTGGGCCCCACCTGGCAGG + Intronic
1152894814 17:82905056-82905078 GCGGCTCTGCCACACCTGCGTGG - Intronic
1156579532 18:38359034-38359056 GTGTCTCTGCCTTGCCTCCCTGG - Intergenic
1157192172 18:45590722-45590744 GCATCTCTGACCCAGCTGCCAGG + Intronic
1157574333 18:48733562-48733584 GGGTCTCTGGCCCCCCTCCCTGG + Intronic
1158941172 18:62406769-62406791 GTGTCGCAGCCCCACCTGCTTGG - Intergenic
1159678870 18:71321555-71321577 GTGTGTCTGCACAACCAGCCAGG - Intergenic
1160753416 19:746228-746250 CTCTCTCTGTCCCTCCTGCCTGG + Intronic
1161027922 19:2045196-2045218 GTGTCTCAGAGCCACCTCCCTGG - Intronic
1161357337 19:3826282-3826304 GCTTCTCTCCCCCAGCTGCCTGG - Intronic
1162043156 19:7982426-7982448 ATGTCCCTGGCCCAGCTGCCAGG - Intronic
1162561968 19:11422278-11422300 GAGTCCCCGCCCCACCTCCCTGG - Intronic
1162566347 19:11447329-11447351 GTGTCTCTGCCCCTCCTGCGGGG - Intronic
1162991921 19:14308722-14308744 ATGTCACTGCCCCTCCAGCCTGG + Intergenic
1163348397 19:16759435-16759457 GTGTCGCTGCCACTGCTGCCTGG - Intronic
1163479359 19:17545634-17545656 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1163725118 19:18918831-18918853 GTTTCCCTGCCCAACCAGCCTGG - Intronic
1164649638 19:29882591-29882613 GGCTCTCTGCCCTCCCTGCCTGG + Intergenic
1165327654 19:35123644-35123666 GTGCCTCTGCCCAAGCAGCCTGG + Exonic
1166110431 19:40619420-40619442 CTGTGTCTGCCCCAACAGCCCGG + Exonic
1166158515 19:40933996-40934018 GTTTCACTGCCCCACAAGCCAGG - Intergenic
1166167497 19:41002214-41002236 GTTTCACTGCCCCACAAGCCAGG - Intronic
1166282040 19:41800689-41800711 CTCTCTCTGCCTCATCTGCCAGG + Intronic
1166380616 19:42353432-42353454 TTGACTCTGTCCCACCTGCTGGG + Intronic
1166449326 19:42884669-42884691 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1166453741 19:42922904-42922926 CTCTCTCTGCCTCACCTGCCAGG - Intronic
1166501429 19:43344190-43344212 GTGTCTGTGTCCCTCCTGCAAGG + Intergenic
1166706958 19:44913336-44913358 GGGTCTCTGTCCCACCAGGCTGG + Intergenic
1167342251 19:48922760-48922782 GTGGCTCGGCCTCAGCTGCCTGG + Exonic
1167384905 19:49157609-49157631 GTGTCTCTCTCCCCCCGGCCCGG + Intergenic
1167719580 19:51169094-51169116 GTCTCTCTGCCTCGGCTGCCAGG - Intergenic
1167743769 19:51339573-51339595 GTGACTCCGCCCCCCTTGCCAGG + Intronic
1168171991 19:54595452-54595474 GTGGCTGCTCCCCACCTGCCTGG - Intronic
925123754 2:1439160-1439182 GCGCCTCTGCCCCAGCTGCTGGG + Intronic
925278887 2:2669388-2669410 GTGCCTCAGCCTCACATGCCGGG + Intergenic
925342860 2:3148948-3148970 GGGTCTCTGCCCCAGCTGCAGGG - Intergenic
925953681 2:8939560-8939582 GTGTCTCTGACCCTGCAGCCTGG - Intronic
927694004 2:25228089-25228111 GGGTCCCTGCCCCACCCGCCTGG - Exonic
927708499 2:25311373-25311395 GTGTCTCTCCCCACCCTCCCTGG + Intronic
927784622 2:25965085-25965107 GTTTCTCTGCCAGCCCTGCCGGG + Intronic
927861542 2:26562912-26562934 CTGGCTGTGCCCCACTTGCCAGG - Intronic
930606056 2:53494302-53494324 GTGTATCAGCACCACCTGCAGGG + Intergenic
930742005 2:54841292-54841314 GTGTCTCTACTCCTCCTGGCGGG + Intronic
931721521 2:65070590-65070612 GAGGCTGGGCCCCACCTGCCTGG + Intronic
932516448 2:72354973-72354995 TTGTCTCTCCTCCACCTCCCAGG - Intronic
932528057 2:72494335-72494357 GTTTCCATCCCCCACCTGCCTGG - Intronic
933606601 2:84390148-84390170 GAGTGTCTGCCCCCACTGCCTGG - Intergenic
935038799 2:99405399-99405421 GTGCCTCTGCTCCCCCTGCATGG - Intronic
935084060 2:99827360-99827382 GTGTCTCTGTCACACCCTCCTGG - Intronic
935615381 2:105074696-105074718 GTGTGTGTGCCACAACTGCCTGG - Intronic
936236602 2:110747677-110747699 GTGGCTCTTCCTCCCCTGCCAGG - Intronic
937231040 2:120398403-120398425 GTGTCTCTCAGCCAGCTGCCGGG - Intergenic
937967644 2:127526160-127526182 AGGTCCCTGCCCCACCTGACTGG + Exonic
938759691 2:134412711-134412733 TTCTCTCTGCCCCACCCCCCAGG + Intronic
939852737 2:147319876-147319898 GTGACCCTGCCCCACTTGGCTGG + Intergenic
946437248 2:219665453-219665475 GTCTCTCTGCCCCTCCTGGCTGG - Intergenic
947105468 2:226663732-226663754 GTCTCTTTCCCCCAGCTGCCAGG - Intergenic
948443946 2:238017625-238017647 GTGTCTCGGCCCAAATTGCCAGG + Intronic
948865272 2:240771851-240771873 ATGTCACAGCCCCACCTCCCGGG - Intronic
1170753664 20:19176565-19176587 GTGTCCAAGCCCCACCTGCTAGG - Intergenic
1172442742 20:34977567-34977589 GTGTCACAGCCCCCCCAGCCTGG - Intronic
1173806034 20:45925894-45925916 GTCTCCCTTCCCCAGCTGCCAGG + Intergenic
1173836822 20:46131402-46131424 GTGTATCTGGACCACCTGCAAGG + Intergenic
1173958879 20:47055997-47056019 GTGTCTCTGCCACACAAGTCGGG - Intronic
1174199730 20:48798812-48798834 GTGTATCTGACCCTCCTGCTGGG + Intronic
1175397391 20:58675727-58675749 GTGTCTGTTGCCTACCTGCCAGG + Intronic
1175540666 20:59745759-59745781 GTGGATCTGAGCCACCTGCCAGG - Intronic
1175798371 20:61786251-61786273 GTGTAGCCGCCCCTCCTGCCTGG - Intronic
1176059204 20:63164937-63164959 GTGTCTCTGCCCCCAGAGCCAGG - Intergenic
1176103440 20:63374928-63374950 GTATCTCTGCCCCATCAGCCTGG - Intronic
1176154975 20:63614792-63614814 CTCTCTCTGCCTCAGCTGCCAGG + Intronic
1176976407 21:15326784-15326806 GTGTTTCTGCTCCCTCTGCCTGG + Intergenic
1178370258 21:32021374-32021396 GTGTCTATGACCCACCTTCATGG - Intronic
1178998955 21:37436364-37436386 GTGTCAGTGCCCCAGCTTCCAGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179788928 21:43744342-43744364 GTGACGCTGCCCCTTCTGCCAGG - Intronic
1179995643 21:44972818-44972840 GCGTCTCCACCCCACCTGCCTGG - Intronic
1180800148 22:18627859-18627881 GTGTCTCTGTGCCCCTTGCCTGG - Intergenic
1180851382 22:19023424-19023446 GTGTCTCTGTGCCCCTTGCCTGG - Intergenic
1180881239 22:19204909-19204931 GTGCCTCTGCCCCACCCAGCCGG + Intronic
1180927668 22:19567329-19567351 AGGTCCCTGCCCCACCTTCCTGG - Intergenic
1181221568 22:21367407-21367429 GTGTCTCTGTGCCCCTTGCCTGG + Intergenic
1181489037 22:23249989-23250011 GTCTCTCTGTCTCACCTGGCGGG + Intronic
1181534075 22:23532870-23532892 CTGTCTCTGCCCCTCCAACCTGG - Intergenic
1181729875 22:24837284-24837306 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1181910616 22:26235484-26235506 GTCTCTTTGCCCCTCCAGCCAGG - Intronic
1182049098 22:27299588-27299610 CCTTCTCTTCCCCACCTGCCTGG - Intergenic
1182666618 22:31964816-31964838 GTGCCACTGCCCCTCCAGCCTGG - Intergenic
1183424902 22:37734240-37734262 GGGTCTCTGCCCCACCCCTCCGG - Intronic
1183430465 22:37762669-37762691 GGGTCACTCCTCCACCTGCCTGG - Intronic
1183683618 22:39349691-39349713 GTGTCCCTGCCCCGCATCCCCGG - Intergenic
1184058159 22:42066329-42066351 GAGGCTTGGCCCCACCTGCCTGG + Intronic
1184127732 22:42500206-42500228 AGGCCTCCGCCCCACCTGCCAGG - Intergenic
1184309871 22:43634177-43634199 GTGAGTGTGTCCCACCTGCCAGG - Intronic
1184320743 22:43740383-43740405 CTGTCTCCTCCTCACCTGCCTGG + Intronic
1184351618 22:43947777-43947799 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1184666330 22:45991016-45991038 GTGCCTTTGCCCTCCCTGCCTGG + Intergenic
1184731964 22:46375459-46375481 GGGTCTCCACCCCACCTCCCAGG + Intronic
1184865915 22:47201892-47201914 GGGTGTCTGCTCCAGCTGCCTGG - Intergenic
1185102069 22:48845906-48845928 CTGTGGCTGCCCCACCTGCCTGG - Intronic
1185221780 22:49632691-49632713 GTGGCTCAGCGCCACCTGCCGGG + Intronic
950189448 3:10966457-10966479 GAGCCTCCACCCCACCTGCCAGG - Intergenic
950408308 3:12817939-12817961 CTCACTCTGCCCCAGCTGCCTGG - Intronic
950417168 3:12875348-12875370 GTGTCTGGGCCCTGCCTGCCTGG + Intergenic
950799572 3:15539247-15539269 GTCTCTCAGGCCCATCTGCCTGG - Intergenic
951555641 3:23917717-23917739 ATGGCTCTGCACCAACTGCCGGG - Intronic
952407753 3:33019794-33019816 GAGCCTCAGCCACACCTGCCTGG - Intronic
954624254 3:52013931-52013953 GAGTCTCTGTCCCTGCTGCCTGG - Intergenic
954652362 3:52172877-52172899 GTGTCTGAGCTCCACCTGCAGGG - Intergenic
954756180 3:52841440-52841462 GTGTGTTTGCCCCAGCTGCATGG - Intronic
956732000 3:72204678-72204700 GTGTCACTGCCCCATCTATCAGG - Intergenic
959086141 3:101852411-101852433 GTTTCTCTTGCCCACCTACCAGG - Intronic
961714017 3:128846633-128846655 GTGTCTGGGCCCTGCCTGCCTGG - Intergenic
961783889 3:129337853-129337875 GTGTCTGGGCCCTGCCTGCCTGG + Intergenic
961785187 3:129343290-129343312 GTGTCTGGGTCCCGCCTGCCAGG + Intergenic
962324664 3:134423212-134423234 CTGGCTCTGTCCCATCTGCCTGG + Intergenic
963123668 3:141796468-141796490 TTGTTTCTGCCTCACCTGACAGG + Intronic
963959994 3:151299227-151299249 ATGTCACTGCTCTACCTGCCAGG + Intronic
965643999 3:170860780-170860802 CTCTCTCTGCCTCAGCTGCCAGG + Intergenic
967889469 3:194354835-194354857 GTGCCACTGCCCCTCCAGCCTGG - Intergenic
968900165 4:3427163-3427185 CTGTGCCTGCCCCACCTGCCTGG - Intronic
969137893 4:5045173-5045195 GAGTCTTTGAGCCACCTGCCAGG + Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
969536897 4:7761884-7761906 GCGTCCCCGCCCGACCTGCCTGG + Exonic
969642403 4:8406680-8406702 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
973245242 4:48004161-48004183 CTCTCTCTGCCTCAGCTGCCAGG + Intronic
975632294 4:76416152-76416174 CTCTCTCTGCCTCAGCTGCCAGG + Intronic
981379335 4:144054718-144054740 AGGTCTCTCCCTCACCTGCCTGG - Intergenic
983011315 4:162550940-162550962 CTCTCTCTGCCTCAGCTGCCAGG + Intergenic
984256738 4:177398554-177398576 ATGTTTCTGCCCCAGCTGTCTGG + Intergenic
984709842 4:182875845-182875867 GTGGCCCTGCCCTCCCTGCCTGG - Intergenic
984839143 4:184051985-184052007 GTCTCCCTGCCCCACCTGCCAGG - Intergenic
985580339 5:692729-692751 GTCTGACAGCCCCACCTGCCAGG + Intronic
985594997 5:784110-784132 GTCTGACAGCCCCACCTGCCAGG + Intergenic
985613290 5:902862-902884 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
985709018 5:1417807-1417829 GTGTCTCTGCCTCAGCATCCTGG - Intronic
985949863 5:3215017-3215039 GTGTCTCTGCCCCTCATGGGTGG - Intergenic
987359700 5:17095656-17095678 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
992329747 5:75703807-75703829 CTGACTCTCCCCCACCTCCCTGG - Intronic
994591807 5:101783455-101783477 GTCACTCTGCGCCACCTCCCTGG + Intergenic
995140371 5:108728420-108728442 GTGCTCCTGCCCCACCTCCCAGG - Intergenic
995621383 5:114029862-114029884 GTCTTTCTGCCCCACATGCTAGG + Intergenic
996083686 5:119282684-119282706 GGGTCTATGCCCCACATGCCAGG - Intronic
997212855 5:132087691-132087713 CTTTCTCTGCCCCACAGGCCAGG - Intergenic
997630005 5:135360282-135360304 GTCTCCCTTCCCCAGCTGCCAGG + Intronic
997858920 5:137398339-137398361 GTTTCTCTGGCCCATCTCCCAGG - Intronic
999380201 5:151116278-151116300 GTGTCTGTGCCCCACATCCCTGG + Intronic
1001207559 5:169778598-169778620 GTTGCTCTGCCCTACTTGCCTGG + Intronic
1001328140 5:170744294-170744316 GTGGCTCTCTGCCACCTGCCGGG - Intergenic
1001654721 5:173340675-173340697 GTGGCTCTGGGCCACCTGGCAGG + Intergenic
1002524640 5:179808122-179808144 GGACCTCTGCCCCACCCGCCCGG + Intronic
1002575596 5:180172154-180172176 GTGGCCCTGCCCGTCCTGCCTGG - Intronic
1002638590 5:180619942-180619964 GTGTATCTGTCACACCTACCCGG - Intronic
1005763071 6:28985663-28985685 GTGTCTCTGCTCCCCCGCCCTGG - Intergenic
1005890917 6:30137069-30137091 GGGTGTCTGCCCCATCTGCCAGG + Exonic
1006450576 6:34103650-34103672 GGGCCTCTGCCCTGCCTGCCTGG - Intronic
1006652106 6:35559995-35560017 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1007496460 6:42263230-42263252 GCTGCTCTGCCCCACCTGCCTGG - Intronic
1007622272 6:43222474-43222496 GTGGCGCAGCACCACCTGCCCGG - Intronic
1008895680 6:56552013-56552035 TTGTAACTGCCCCACCTGCCTGG + Intronic
1009374753 6:62953424-62953446 GTGTTTTTTCCCCTCCTGCCAGG + Intergenic
1010011491 6:71052263-71052285 TTCTCTCTGTCCCACCAGCCTGG - Intergenic
1012223916 6:96684025-96684047 GTCTCTCAGCCCCAGCTGGCAGG + Intergenic
1013997024 6:116321085-116321107 CTGTCTCTGCTCCATCTTCCTGG + Intronic
1015034003 6:128630498-128630520 CTGCCTCTGCCCTACCTGTCTGG - Intergenic
1016079601 6:139839712-139839734 GTTCCTCTGCCCAACCTGCCTGG + Intergenic
1016222381 6:141691177-141691199 GTGCCACTGCACCACCGGCCTGG - Intergenic
1018034244 6:159867744-159867766 CAGTCTCTGCCCCATCTCCCTGG - Intergenic
1019991174 7:4692436-4692458 GTGCCACTGCCCCTCCAGCCTGG - Intronic
1022567790 7:31420874-31420896 CTTTCCCTGCCCTACCTGCCAGG + Intergenic
1024460805 7:49657477-49657499 GTTTCTTTGCCACATCTGCCAGG - Intergenic
1025827822 7:65024863-65024885 GATTCCCTGTCCCACCTGCCAGG - Intergenic
1026827441 7:73593433-73593455 AGGTCTGTGCCCCACCTGTCGGG + Exonic
1026969812 7:74461062-74461084 ATGGCTCTCCCCAACCTGCCTGG + Intronic
1030162453 7:106522904-106522926 GTGTCTCTCCCCTAGCTTCCAGG - Intergenic
1031949194 7:127874173-127874195 GTGTCTCTGCCCCACCTGCCAGG + Intronic
1032011322 7:128350068-128350090 GAGTTTCTGCCTCACCTCCCAGG + Intergenic
1033163407 7:139017102-139017124 GTCACTCTGCCCCAGCTGCGAGG - Intergenic
1033251943 7:139768054-139768076 GTGCCTCTTGCCCACCTTCCAGG - Intronic
1034352694 7:150427764-150427786 GTCTCTCTGCCCTTGCTGCCAGG + Intergenic
1034606370 7:152319838-152319860 CTCTCTCTGCCTCAGCTGCCAGG + Intronic
1035017980 7:155782791-155782813 GTGGCCCTCCCGCACCTGCCTGG - Intergenic
1035238909 7:157517487-157517509 CTGCCTCTGCACCACCTGCCTGG - Intergenic
1035473616 7:159127620-159127642 GAGTCTCTTCCACACCTGCAGGG + Intronic
1035725408 8:1822246-1822268 GATTTTCTGCCCAACCTGCCTGG + Intergenic
1035774915 8:2180824-2180846 GTGTTTTTCCCACACCTGCCTGG + Intergenic
1036690536 8:10941892-10941914 CTGCCTCTGCCCCAGCAGCCAGG + Intronic
1037822759 8:22142998-22143020 GTGTTTCCACCCCACATGCCCGG - Intergenic
1039428358 8:37505568-37505590 GGGCCTCTGCCCCTTCTGCCTGG + Intergenic
1039804929 8:40989713-40989735 GAGGCTCTGCCCCACTTCCCTGG + Intergenic
1040105001 8:43536516-43536538 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1040551228 8:48439084-48439106 CTGCATCTGTCCCACCTGCCGGG - Intergenic
1040604872 8:48921710-48921732 GGGTCTCTGCCCTGCCCGCCTGG + Exonic
1041719839 8:60965694-60965716 GCGTCTCTCCCCCACCAACCAGG - Intergenic
1042023620 8:64399440-64399462 GTCTTGCTGCCCCACCTGCTGGG - Intergenic
1045492896 8:102683859-102683881 GTGTCTCTGAACCACCTCACGGG + Intergenic
1046762577 8:118036751-118036773 GTGTCTCTTAACCACCTTCCAGG + Intronic
1048241019 8:132741588-132741610 GTCTCTCTGCCTCGGCTGCCAGG - Intronic
1048307243 8:133292929-133292951 CTGCCTATGCCCTACCTGCCTGG - Intronic
1049000909 8:139825220-139825242 GTTTCTCTGCCCACCCTGCGTGG - Intronic
1049374187 8:142281288-142281310 GAGCCTCTGCCCCACTGGCCTGG + Intronic
1049516221 8:143058417-143058439 CTCTCTCTGCCTCAGCTGCCAGG - Intronic
1049743909 8:144255011-144255033 CTGTCCCTGCCCCGCTTGCCTGG + Intronic
1049872914 8:144994893-144994915 GTTTGTCTGGCCCACCAGCCCGG + Intergenic
1052269574 9:26613646-26613668 TTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1053373708 9:37585951-37585973 GTACCTCTGCCCAAACTGCCTGG - Intronic
1056268585 9:84924414-84924436 GACTGTCTGGCCCACCTGCCAGG + Intronic
1056835407 9:89951212-89951234 GTGTCAGTGCCCCACCTGCCAGG - Intergenic
1057225102 9:93288999-93289021 GTGTCCCTGGACCCCCTGCCTGG - Exonic
1057690128 9:97276517-97276539 GTGGCTCGGCCCCACCTGCCTGG + Intergenic
1058505619 9:105662943-105662965 CTGTCTCTGAGCCACCTCCCAGG - Exonic
1060220336 9:121761128-121761150 GTGCCTCAGCCCCACCTACCCGG + Intronic
1061913545 9:133737675-133737697 GTGCCCCTTCACCACCTGCCTGG + Intronic
1061938540 9:133871896-133871918 GTGTCCCTGAACCACCTGCTGGG - Intronic
1062125077 9:134855813-134855835 GTGGCTCTGCCTTACCTCCCTGG + Intergenic
1062286258 9:135773869-135773891 GAGTGCCTGCCCCACCAGCCGGG + Intronic
1062367503 9:136218254-136218276 GTGCATCTGCCCCACCAGCCAGG - Intronic
1189599217 X:42604151-42604173 CAGTCTTTGCCCAACCTGCCTGG - Intergenic
1192583252 X:72301899-72301921 GTGATTCTGCCCCTCCCGCCTGG + Exonic
1192631713 X:72782417-72782439 GTGTCTCTGGCCCTCTTGCAGGG + Intronic
1192649996 X:72938384-72938406 GTGTCTCTGGCCCTCTTGCAGGG - Intronic
1195917717 X:109952252-109952274 GTGTCTCTTACCAGCCTGCCAGG + Intergenic
1198344690 X:135747857-135747879 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic
1199715318 X:150503755-150503777 GTGCCTCAGCCCCACCTCCAGGG + Intronic
1200215032 X:154364430-154364452 GTGTCCCTGGCCACCCTGCCTGG - Intronic
1201708169 Y:16959639-16959661 CTCTCTCTGCCACAGCTGCCAGG + Intergenic
1201974350 Y:19832106-19832128 CTCTCTCTGCCTCAGCTGCCAGG - Intergenic