ID: 1031955923

View in Genome Browser
Species Human (GRCh38)
Location 7:127942238-127942260
Sequence GTCAAAAATAAGACCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031955923 Original CRISPR GTCAAAAATAAGACCCTTGA AGG (reversed) Intronic
900326988 1:2113166-2113188 GTCAGAACTGAGACCCTGGAGGG - Intronic
902556850 1:17251964-17251986 GGCACCAATCAGACCCTTGAAGG + Intronic
906066474 1:42984714-42984736 GGCAGAAATAAAACCCTTGTGGG + Intergenic
907066188 1:51485796-51485818 CTCAAAAAAAAGACCCTCGATGG - Intronic
909339513 1:74515925-74515947 GTCAGACATCAGAACCTTGAAGG - Intronic
910431227 1:87161491-87161513 GTCAAAAAGAAGCCACTTGGTGG + Intronic
918607410 1:186444998-186445020 GTGAATAATAATACCCTGGAGGG - Intronic
920062878 1:203239968-203239990 GTCTAAGAAAAGACCCTTGTGGG + Intronic
921620326 1:217319179-217319201 AACAAAAAAAAGATCCTTGATGG + Intergenic
922392973 1:225166206-225166228 CTCAAAAGTAAAACCATTGATGG - Intronic
1064828511 10:19433824-19433846 GTCCATAGGAAGACCCTTGAAGG + Intronic
1068102283 10:52570347-52570369 GTCAATAATCTGACCCTTGTTGG - Intergenic
1069019527 10:63470651-63470673 GTCTCAAATAACATCCTTGATGG + Intergenic
1074505411 10:114065682-114065704 GTTAAAAATATGACCTTTGGTGG - Intergenic
1074839526 10:117335482-117335504 GGCAAAAATAACACCACTGATGG + Intronic
1080831065 11:35893850-35893872 ATAAAAAATGAGGCCCTTGAAGG + Intergenic
1084367269 11:68710157-68710179 CTCAAAAAAAAGACCCCTGTAGG + Intronic
1086796683 11:91113508-91113530 GTCAAAGATAAGATGGTTGAAGG + Intergenic
1087752217 11:102019583-102019605 GTGCAAAATTAGACCCTTGAAGG + Intergenic
1089081555 11:115780490-115780512 GACAAAAATACTACCTTTGAGGG - Intergenic
1093242857 12:16698998-16699020 GGAAAAAATGAGACCATTGATGG + Intergenic
1093945870 12:25109170-25109192 CTCAAATATAAGCCCCTTGAGGG - Intronic
1104207129 12:126649948-126649970 GACAAAAATATAATCCTTGAAGG - Intergenic
1106687376 13:32075104-32075126 GTTAAAAATCAGACCTATGAAGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109110127 13:58306570-58306592 CTCAACAATATGACCCTTTAGGG + Intergenic
1109936032 13:69285904-69285926 GGCATAAATATGACCATTGAAGG + Intergenic
1114937252 14:27556094-27556116 GTCAAAAATCAGACGGTTGTAGG - Intergenic
1120236069 14:81892475-81892497 TACAAAAATAAGACACCTGAGGG - Intergenic
1126682884 15:51220308-51220330 GGCAATAATAAGTGCCTTGAAGG - Intronic
1127886747 15:63208096-63208118 GTAAAAAATAAGACTTTTAAGGG - Intronic
1134115867 16:11548227-11548249 ATCAAAACGAGGACCCTTGAAGG + Exonic
1138470945 16:57235815-57235837 GTCAAAAATAAGACCAAGGCAGG - Intronic
1139087920 16:63610974-63610996 GTCAAAAATAAGATGGTTGTAGG + Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1140959428 16:79897824-79897846 GTGAAAAACAAGACGCTAGAAGG - Intergenic
1141006403 16:80356917-80356939 GACAAACCTAAGACCCATGATGG + Intergenic
1141553432 16:84821182-84821204 GTCAGACATCAGACCCTGGATGG - Intronic
1145714284 17:27005168-27005190 GTCAAAGATCAGACACTTGTAGG + Intergenic
1150824431 17:68462183-68462205 GGCAAAAATAAGACAGGTGAGGG - Intergenic
1153009244 18:523057-523079 GTAAACACTAAGATCCTTGAGGG - Intergenic
1153026400 18:676764-676786 GTGATAAATGGGACCCTTGAGGG - Intronic
1153720596 18:7897607-7897629 ATCAAAAATAAGATCTTTGAGGG - Intronic
1153844527 18:9037027-9037049 GTCTAAAATTAGAAGCTTGAGGG + Intergenic
1157111563 18:44825280-44825302 GTAAAAGATCAGAGCCTTGAAGG - Intronic
1157408092 18:47440665-47440687 GGGAAAAATAAGAGCCTTGAAGG + Intergenic
1157976599 18:52334778-52334800 GTCAGAAATATGAACCTAGAGGG - Intergenic
1158013100 18:52751447-52751469 ATGAAAATTAAGACCCTTCAGGG + Intronic
1158350242 18:56557651-56557673 AATAAAAATAAGCCCCTTGAGGG + Intergenic
1158656869 18:59345308-59345330 GTCAAAAATAAAACATTTTAAGG - Intronic
1166239263 19:41478703-41478725 AACAAAAATATGTCCCTTGAAGG + Intergenic
1166567298 19:43772982-43773004 GTGAAAACTAAGATCCTGGAAGG + Intronic
926550007 2:14289673-14289695 TTCAAAAATATTACCCTAGATGG - Intergenic
926909743 2:17841142-17841164 ATTAAAAATAGGACCCTTGCAGG + Intergenic
929262582 2:39882593-39882615 CTTAAAAAAAAGACCCTTCAAGG - Intergenic
932602988 2:73142991-73143013 GGCAATAATGAGACACTTGAAGG - Intronic
933841144 2:86286505-86286527 GTTCAAAAAATGACCCTTGATGG - Intronic
934902654 2:98172697-98172719 GTCAAAAGTAAGCTCCTAGATGG + Intronic
935475502 2:103516317-103516339 GTCAAAAAGAAGAAATTTGAAGG - Intergenic
936662252 2:114555368-114555390 CTACAATATAAGACCCTTGAAGG - Intronic
937655731 2:124372997-124373019 GACAAAAATTATATCCTTGAGGG + Intronic
939455099 2:142423688-142423710 GTAAAAAATACAACCCTGGATGG - Intergenic
939899089 2:147828267-147828289 ATCAAAATTAAGACCCTAGCTGG + Intergenic
941229910 2:162899049-162899071 TCTAAAGATAAGACCCTTGAGGG + Intergenic
943934001 2:193891238-193891260 GTCAAAAATAAGAGACGTGGTGG + Intergenic
945418285 2:209602220-209602242 GTCAAAAAGAAAACAGTTGAGGG + Intronic
945722624 2:213437317-213437339 TTTATAAATAAGAGCCTTGAAGG - Intronic
945762468 2:213930989-213931011 ATTAAAACTTAGACCCTTGAAGG - Intronic
947189378 2:227486092-227486114 GTTAAACCTAAGACCCTGGATGG - Intronic
947677430 2:231995503-231995525 GAAAAAACTCAGACCCTTGAAGG - Intronic
1168754634 20:307893-307915 ATAAAAAATAAGAACTTTGATGG + Intergenic
1169273943 20:4220871-4220893 GTAAACAGTAAGGCCCTTGAGGG + Exonic
1170005321 20:11662464-11662486 CTCAAAAAAAAAACCCTAGAAGG - Intergenic
1171814002 20:29767322-29767344 TTAAAAAAAAATACCCTTGATGG + Intergenic
1172977135 20:38914619-38914641 GTCAGAAATCAGAGCATTGAAGG - Intronic
1173628980 20:44495744-44495766 GTAAGTAATAAGACCCTTTAGGG + Intergenic
1174284551 20:49463288-49463310 GTCAAAAATTAGAGCCACGAGGG + Intronic
1175687839 20:61044363-61044385 GTCAAAATTTAGTCCCTGGAGGG + Intergenic
1177691666 21:24518079-24518101 GTCAAAAATCAGATGTTTGAAGG - Intergenic
1179332800 21:40421642-40421664 GCCAAAGATATGCCCCTTGATGG - Intronic
1182769962 22:32787745-32787767 GTGAAAAATGAGACCCTGGGAGG + Intronic
1182895019 22:33852193-33852215 TTTAAAAATAAGACTCATGATGG + Intronic
1182895270 22:33854456-33854478 TTTAAAAATAAGACTCATGATGG - Intronic
1184032374 22:41902652-41902674 GGCAGAAATAAAACCCTTGTGGG - Intronic
950959524 3:17090698-17090720 GTCAAAAATAAGTTGCTTGTCGG + Intergenic
952642830 3:35618990-35619012 GTCAAAGATAAGACAGTTGTAGG - Intergenic
956124141 3:65995528-65995550 CTCAAAAAAAAAACCCTTTAAGG - Intronic
956868740 3:73395748-73395770 CTCAAACATAAGGTCCTTGAGGG - Intronic
957889801 3:86341870-86341892 GTCAAAAATAAGTTCATTGTAGG + Intergenic
962842382 3:139247322-139247344 GTGAAAAAAAAAACTCTTGATGG - Intronic
964929839 3:162003780-162003802 GTCAAAGATAAGTCTCTTGTTGG + Intergenic
965556039 3:170019334-170019356 GTAAAAGATAAGACTCTTTAGGG - Intergenic
965954865 3:174357602-174357624 ATTACAAATAAGACACTTGATGG - Intergenic
969320971 4:6412386-6412408 GAGAAAAATGAGACCCTGGAAGG + Intronic
971076337 4:23153445-23153467 GTTAAAAATGAGATCCTTAAAGG + Intergenic
971128028 4:23775666-23775688 GGTAAAAATAAGAGCCTGGAAGG - Intronic
971870886 4:32237095-32237117 GTCAAATAAAAGACCCTTGAAGG + Intergenic
972353784 4:38261435-38261457 GTCCAAAACTAGACCCTGGAGGG - Intergenic
973882430 4:55287482-55287504 CTCACAAAAAAAACCCTTGATGG + Intergenic
977286150 4:95109561-95109583 GGAAAAAATAAAACCCTGGATGG - Intronic
978907540 4:114025508-114025530 TACAAAAATATTACCCTTGATGG - Intergenic
979835084 4:125356944-125356966 GTAAAAATTAAGTCCCCTGAGGG + Intronic
980989237 4:139724764-139724786 AAAAAAAAAAAGACCCTTGAGGG - Intronic
982441990 4:155447342-155447364 GTCAAACATAAGACCTTAAAAGG + Intergenic
984401663 4:179273498-179273520 GGCAAAAATAAAATCCTAGAAGG + Intergenic
984829854 4:183962775-183962797 TTAAAAAATATGACCCTTTAGGG + Intronic
985687102 5:1288394-1288416 TTCAAAACTAAGACCCAAGAGGG + Intronic
985941933 5:3143184-3143206 GTCATTAATAAGAACATTGAGGG - Intergenic
986574806 5:9200671-9200693 GTCAGAAAGAAGACTCTTCATGG + Intronic
989442996 5:41494082-41494104 GTAAAAAATAAAACCCGGGAGGG - Intronic
990076530 5:51852401-51852423 GGCAAAAATAAAACCTTTGCTGG + Intergenic
990214936 5:53520027-53520049 GTCAAAAATCAGAAGCTTGTAGG - Intergenic
990561082 5:56983503-56983525 GTCCAAAATAAAAACCTTGCAGG + Intergenic
991403988 5:66283978-66284000 GCCACACATAAGACCCTCGAGGG - Intergenic
996118113 5:119641330-119641352 GTCAAAATTAGTACCCTGGAGGG - Intergenic
996991206 5:129634630-129634652 GTCAAAAATAAGATAGTTGTAGG - Intronic
997393849 5:133540546-133540568 GTCAAAAAGAAAATCCATGAGGG - Intronic
998471370 5:142386509-142386531 GCCAAAAATAAGACCCACGTGGG + Intergenic
1000012566 5:157246281-157246303 TTCAAATATGAGCCCCTTGAAGG + Intronic
1001787088 5:174423124-174423146 GTCAAAAAGAAGACACTTGATGG - Intergenic
1003829035 6:9985686-9985708 GTCACAAATAATAAACTTGATGG - Intronic
1004279467 6:14268752-14268774 GGCAAAAAGAGGACTCTTGATGG + Intergenic
1005196904 6:23297831-23297853 GGCAAAAATAAGCTCCTTGAAGG - Intergenic
1005830326 6:29665846-29665868 GTCAATAAAAAGTCCCTTGAGGG + Intronic
1007185577 6:39968694-39968716 GTCAGAAAAAAAACCCTTAAAGG + Intergenic
1008591525 6:52998171-52998193 TTAAAAAATAAGCTCCTTGAGGG - Intergenic
1009332093 6:62436161-62436183 GTCAAAGATAAGATGGTTGATGG + Intergenic
1011388891 6:86829065-86829087 CTTAAAAATAAGCCCCATGAAGG - Intergenic
1011952611 6:92985467-92985489 GTCATAATTAAGACCCTGTAGGG - Intergenic
1012539931 6:100351005-100351027 TTCAAAAATAAAACACTTGAAGG + Intergenic
1012656263 6:101825391-101825413 GTCAAATATAAAACTATTGATGG + Intronic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1018917200 6:168141391-168141413 GTCAAAAATGAGTTCCTTGTAGG + Intergenic
1021376382 7:19912694-19912716 TTCAAAAATAAGAGTCTGGATGG + Intergenic
1021432565 7:20577454-20577476 GTCAAAAACTAGACCATGGATGG + Intergenic
1028646788 7:93107242-93107264 GACAAAATTAAGATGCTTGAAGG - Intronic
1029513309 7:101010326-101010348 CCCCAAAATAAGACCCTTTAGGG - Intronic
1030801973 7:113863589-113863611 GTTGAAAATAAAACCCTTCAAGG - Intergenic
1031580199 7:123464915-123464937 GTCAAACATCATAACCTTGAAGG - Exonic
1031955923 7:127942238-127942260 GTCAAAAATAAGACCCTTGAAGG - Intronic
1032795736 7:135274792-135274814 CTCTAAAATAAGGCCCTTAAAGG - Intergenic
1033189398 7:139263354-139263376 CTAAAAAATAAGCTCCTTGAGGG - Intronic
1034708149 7:153165367-153165389 GTCAAAAATCAGTTCATTGAAGG + Intergenic
1036617159 8:10397290-10397312 GTCAATACTAAGGCCTTTGAGGG - Intronic
1040695688 8:49994917-49994939 GTTAATTATAAGACCCATGAGGG - Intronic
1042241584 8:66669213-66669235 ATCAAAACTAATACCCTTTATGG - Intronic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1044914427 8:97097501-97097523 GTCAAGAATAAGAAGCTTAAAGG + Intronic
1045940389 8:107731649-107731671 GTAAAAAATTAAACCCTTGTGGG + Intergenic
1046059821 8:109124994-109125016 GTGATAAGTAAGAGCCTTGAAGG - Intergenic
1047261727 8:123268455-123268477 GTCATAAATAACACTTTTGAAGG + Intronic
1049041928 8:140118990-140119012 GTTTAAATGAAGACCCTTGACGG - Intronic
1049841453 8:144775656-144775678 GTCAGAAAGAAGACCCCTGTGGG + Intronic
1050765053 9:9122514-9122536 GTCCAAAATAAAACCCAAGATGG - Intronic
1051964651 9:22812786-22812808 GATAAAAATAAGACACTTTAAGG - Intergenic
1054833595 9:69652692-69652714 TTCAAAAACAAGACCCTGGCTGG + Intronic
1056043553 9:82692636-82692658 ATCAAAAATAATAGCCTAGAGGG - Intergenic
1056079379 9:83075086-83075108 GGCAAAATTAATACTCTTGAAGG - Intergenic
1057308615 9:93927342-93927364 GTCAAATAGAATACCCTTGAAGG + Intergenic
1058293493 9:103275225-103275247 GTCAAAAATAAGATGGTTGTAGG - Intergenic
1185928078 X:4169683-4169705 CCCAAAAATATGACGCTTGATGG + Intergenic
1190776651 X:53557751-53557773 ATAAAAAATAAGCCCCATGAAGG - Intronic
1191017442 X:55825018-55825040 GTCAAAAATAAGTTCCCTGTAGG + Intergenic
1196086623 X:111690563-111690585 GTCCAAAATCAGATACTTGATGG - Intronic
1196471068 X:116027952-116027974 GTCAAAAATAAGTTCATTGTAGG + Intergenic
1196574612 X:117303337-117303359 GTTAAATAAAAGACACTTGATGG - Intergenic
1200879053 Y:8193449-8193471 GTAAAAAATAAGAACTTTGAGGG + Intergenic
1201336515 Y:12887046-12887068 GACAAAAAAAAGAACCTTGGAGG - Intergenic