ID: 1031956194

View in Genome Browser
Species Human (GRCh38)
Location 7:127944928-127944950
Sequence CAGTGTAATCTCTAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031956194 Original CRISPR CAGTGTAATCTCTAGGAAGA TGG (reversed) Intronic
900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG + Intronic
901436731 1:9251141-9251163 CAGGGTCATCTCTGGGATGAAGG - Intronic
901522224 1:9793894-9793916 CAGGGGAAGCTCTAGGAAGCTGG - Intronic
902665283 1:17933315-17933337 GAGTGTCACTTCTAGGAAGATGG + Intergenic
904282585 1:29431570-29431592 CAGTGTAGTAGCTAGGAACATGG + Intergenic
904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG + Intronic
910423079 1:87090155-87090177 CAGTGTACTCTCTGGCAGGAAGG + Intronic
910976058 1:92907389-92907411 AAGAGAAATTTCTAGGAAGATGG + Intronic
912652373 1:111450658-111450680 AAGAGAAATCTCTAGGAAAATGG - Intronic
913718120 1:121560013-121560035 CAGGCTAGTTTCTAGGAAGATGG - Intergenic
916086924 1:161277475-161277497 CTCTGAAATCTCTAAGAAGATGG - Intronic
916839246 1:168583232-168583254 CAGTGTAATATGTGGGATGATGG + Intergenic
918966932 1:191362902-191362924 TTGTGTATTCTCTAGGAAGATGG - Intergenic
919901054 1:202044694-202044716 CAGTGTATGCTCTAGTGAGAGGG - Intergenic
919946009 1:202319305-202319327 CAGTGTGATCTATAGCAGGATGG + Exonic
920766549 1:208839172-208839194 CTGTGTCATCATTAGGAAGATGG + Intergenic
921678275 1:218001801-218001823 GACTCTAAACTCTAGGAAGAAGG + Intergenic
922140162 1:222876397-222876419 AAGTGAAATGTCTGGGAAGAAGG - Intronic
922548567 1:226476806-226476828 TAGTGTCATCTCTGGGAAGTAGG - Intergenic
1064377703 10:14811821-14811843 CAGTGTCATTTCTAAGCAGATGG - Intergenic
1066449703 10:35517597-35517619 CAGTGTCTGCTCTAGGCAGAAGG + Intronic
1066640856 10:37552782-37552804 CACTGTACTTTCTGGGAAGAGGG + Intergenic
1070086223 10:73239759-73239781 CAGTTTAATCCATAGGAATATGG - Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070931798 10:80266122-80266144 CAGTGTATTCTCCAGCAGGAGGG - Intergenic
1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG + Intergenic
1074581993 10:114728056-114728078 CAGAGTAATCTATTGGAAAATGG + Intergenic
1076020506 10:127068633-127068655 CAGTGTAATCTCTGGAAGGTAGG - Intronic
1078059571 11:8034354-8034376 CACTGTAAGCTCTAGGAAGAGGG + Intronic
1078714551 11:13827456-13827478 CACTCTAATCTCTTGAAAGATGG - Intergenic
1079200065 11:18369475-18369497 CACTGTCAGCTCTAGAAAGATGG - Intergenic
1079390055 11:20014326-20014348 CACTGTTATCTCTATTAAGATGG - Intronic
1081024264 11:37989901-37989923 CAATGTTATCTCTAAGAAAAGGG - Intergenic
1082138108 11:48574279-48574301 AAGAATGATCTCTAGGAAGAAGG - Intergenic
1083624106 11:64063271-64063293 CAATATTATCCCTAGGAAGAGGG - Intronic
1084090235 11:66874943-66874965 CAGAGAAAGCTCCAGGAAGAAGG + Intronic
1086467123 11:87066124-87066146 AAGTATTATCTCTAGAAAGATGG + Intronic
1088289873 11:108224310-108224332 CAGAGTTATTTCTAGGAAGATGG + Intronic
1091262719 11:134246599-134246621 CTGTGTAACCTATAGGGAGAGGG - Exonic
1091653592 12:2327715-2327737 CAGCGTAATTACAAGGAAGATGG + Intronic
1092531521 12:9349267-9349289 CAGTGTAGTCCCTGGGCAGAGGG + Intergenic
1094214266 12:27923748-27923770 AAGTGTATTCACAAGGAAGATGG + Intergenic
1096450922 12:51740295-51740317 CAGTGCAAGCACTAGTAAGAGGG - Intronic
1097773774 12:63622280-63622302 CAGTTTAATTCCTAGGAAGGTGG - Intronic
1098210094 12:68154361-68154383 GGGTGTAAGCTCTAGGGAGAAGG - Intergenic
1102827040 12:115956700-115956722 AAGTTTAATCTCCAGGAAGAAGG - Exonic
1112709857 13:102115181-102115203 CAGGGTAACCTCTAACAAGAAGG - Intronic
1113394225 13:109931035-109931057 CAAGGTATTCTCCAGGAAGAGGG + Intergenic
1114389085 14:22286496-22286518 CAATGTAATCTCAAGGATCAAGG - Intergenic
1114615969 14:24068662-24068684 AAGTGTCCTCTCTGGGAAGAGGG - Exonic
1115012316 14:28564156-28564178 CAGTGTAATTTTTAAGAAGCAGG - Intergenic
1115248821 14:31324867-31324889 CAGTGTAAACCATTGGAAGAGGG + Intronic
1117146685 14:52842951-52842973 CTGTGTTATCACTAGGAAGCTGG + Intergenic
1117989329 14:61418420-61418442 CTTTGGAATCTCCAGGAAGAAGG + Intronic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1122173673 14:99899924-99899946 CAGTCTAATCTCTAAGCAGCTGG - Intronic
1122565504 14:102652186-102652208 CTGTTTAATCTCTTTGAAGAAGG + Intronic
1122846179 14:104500414-104500436 GTGTGTACTCTCCAGGAAGAAGG + Intronic
1127804467 15:62506167-62506189 CTGTGATATCTCCAGGAAGAAGG + Intronic
1128542882 15:68549322-68549344 CAGTGTAAACTCCAGGAAGGAGG - Intergenic
1132009655 15:98265210-98265232 CAGTTTAGTTCCTAGGAAGAGGG + Intergenic
1132905293 16:2279301-2279323 CAGTGGAAGCTCTTGGAACAGGG + Intronic
1133427080 16:5701922-5701944 CAGTATAAACTCTAGGAGAATGG + Intergenic
1133510252 16:6451425-6451447 CATTGTTATCACTAGGAATATGG + Intronic
1138660387 16:58513084-58513106 CAGTGTTATCTACAGTAAGAGGG - Exonic
1139002737 16:62533105-62533127 AAGAGTAATCTCTAGGAAAACGG + Intergenic
1139754393 16:69131728-69131750 AAGAGTAATCTTTGGGAAGAGGG - Intronic
1141872347 16:86796014-86796036 CAATGTACTCTCTAGGAGCAAGG - Intergenic
1143054909 17:4155574-4155596 CAGTGTCATCTCAAGAAAGAGGG + Intronic
1146090420 17:29872355-29872377 TAATGTAGTCTCTAGGAATAGGG - Intronic
1148891684 17:50812154-50812176 CACTGTAATCCCAAGGCAGAAGG - Intergenic
1150927354 17:69546932-69546954 CAGAGTAAAATCTAGGAAGAAGG + Intergenic
1152029576 17:77833684-77833706 GAGTGAAAGCTCTAGGAATATGG + Intergenic
1153100943 18:1468891-1468913 CAGTCTAGTCTCCAGCAAGAAGG - Intergenic
1155182446 18:23359519-23359541 CTTTGTAATCTTTAGAAAGATGG - Intronic
1156908615 18:42384208-42384230 CAGTGTATTTTCTAAGAATAAGG + Intergenic
1159948402 18:74460447-74460469 TAGTGTTATCTCCAGGTAGAAGG + Intergenic
1168578168 19:57531056-57531078 CATGGGAATCTGTAGGAAGAGGG - Exonic
926093024 2:10062764-10062786 CAGTTTACTCACTAGGAAAATGG + Intronic
926319713 2:11740806-11740828 TATTGTCATCTCTGGGAAGATGG - Intronic
928129114 2:28636696-28636718 CAGAGTAATGGCTGGGAAGAGGG + Intronic
931128465 2:59304126-59304148 TAGGTTTATCTCTAGGAAGAGGG - Intergenic
931908608 2:66869914-66869936 CAGTGTTATGAATAGGAAGAAGG + Intergenic
932762876 2:74450933-74450955 CAGTGTATTCTCTGTGAAGTTGG + Intergenic
934039156 2:88113642-88113664 CAGTGTCATTTCTAAGAACATGG + Intergenic
936292687 2:111238644-111238666 GACTGTAATCTCTGGGAAGCTGG - Intergenic
936659645 2:114528468-114528490 CAGTCCAAACTCTAGGATGAGGG + Intronic
938073777 2:128321487-128321509 CAGTGTCATGTCTTGGAAAATGG + Intergenic
940188584 2:151014413-151014435 CAGTGTAATAATTAGGAATATGG - Intronic
941739020 2:169013116-169013138 CAGAGTAATTTCTAGAAATATGG + Intronic
942842568 2:180380128-180380150 CTATGTATTCTCTAAGAAGATGG - Intergenic
944143444 2:196481496-196481518 CTGTGAGATCTCTAGGGAGATGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945564554 2:211381058-211381080 CAGAGAAGTCTCTAGGAAAAGGG - Exonic
1169411927 20:5378184-5378206 AAGTGGAATCTCTAGGATGAAGG - Intergenic
1169943254 20:10960844-10960866 CAGCCTAATTTATAGGAAGAAGG + Intergenic
1171105916 20:22432269-22432291 CAGTGTAATTTATGGAAAGATGG + Intergenic
1174531194 20:51215643-51215665 CAGTGTATTCTCCTGGCAGATGG + Intergenic
1175255468 20:57643674-57643696 CACAGAAATCTCTAGGAAAAGGG - Intergenic
1176698483 21:10011121-10011143 CAGTCTAATCACTGGTAAGATGG - Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1178140127 21:29673269-29673291 GAGTGTAACCTTTAGGAAGGTGG - Intronic
1181040019 22:20187726-20187748 CAGTTTACCCTCTGGGAAGAGGG - Intergenic
1181282890 22:21732309-21732331 CAGTGAAAGCTCTAGGGAGTGGG - Intronic
1184403534 22:44287255-44287277 CAGTGGCCTCTGTAGGAAGATGG + Intronic
949111778 3:269923-269945 CAGTGAGATCTCCAGGAAGCTGG + Intronic
949179675 3:1113507-1113529 CATTGTAAATTCTAGGAAAAGGG + Intronic
950915635 3:16642235-16642257 CACTGCAATCTCTATTAAGATGG - Intronic
953231480 3:41068976-41068998 TAGTGTTTTCTCAAGGAAGATGG + Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956758164 3:72410732-72410754 CAGTGTACTCTCTAGGTCCATGG + Intronic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958704443 3:97636371-97636393 TAGTGTACTGTCTAAGAAGATGG + Intronic
958954719 3:100455183-100455205 AGGTGTAATATCTAGGAAGTAGG + Intronic
961372339 3:126439348-126439370 CAGTTAATTCTCTGGGAAGAGGG - Intronic
962422656 3:135241808-135241830 GAGTGAATTCTCAAGGAAGAAGG - Intronic
966280604 3:178222158-178222180 CAGTGTAATCACTAAGACCACGG + Intergenic
966543821 3:181121724-181121746 CAGTTTAATGTCTAGCAACATGG - Intergenic
969618020 4:8265039-8265061 CCGTGGAGTCTCTAGGACGAGGG + Intergenic
970419023 4:15887754-15887776 CACTGTAATCTTTAGGAACCAGG + Intergenic
970664917 4:18325872-18325894 CAGAGGAAACCCTAGGAAGAAGG - Intergenic
972464591 4:39342976-39342998 CAGTGTAGTCACAAGGAATAGGG - Intronic
975713081 4:77179822-77179844 CAGTTTCATCTCTTGGAGGATGG + Intronic
977610445 4:99024765-99024787 CAGTCTGGTCTCCAGGAAGAAGG + Intronic
979309814 4:119190018-119190040 CACTCTATTCTGTAGGAAGAAGG + Intergenic
979388760 4:120101412-120101434 TTGTGTATTCTCTAAGAAGATGG + Intergenic
981282420 4:142973630-142973652 CAGTGTTTTCTCTCTGAAGATGG + Intergenic
988329487 5:29816961-29816983 TAGTGTAATATCAAGCAAGATGG + Intergenic
989025825 5:37067000-37067022 CAGAGTAATTTTTAGGAAGTAGG + Intergenic
989149699 5:38286759-38286781 CTGTGTAAACTATAGCAAGATGG - Intronic
989960441 5:50407838-50407860 CAGGCTAGTTTCTAGGAAGATGG + Intronic
992164644 5:74037589-74037611 CAATGTATTCTCTATGAAGAAGG + Intergenic
992442389 5:76808344-76808366 CTGTGAAATCTCTGGGAAGAAGG - Intergenic
992881245 5:81112619-81112641 CAGTGTCGTCTTTATGAAGACGG - Exonic
999564035 5:152837784-152837806 CCATCAAATCTCTAGGAAGATGG + Intergenic
999796129 5:154991358-154991380 AAGTGTAAACTCTAGGAAGAGGG + Intergenic
1000473215 5:161672249-161672271 CAGTGAAATCTCTAGGTAAAGGG + Intronic
1005093418 6:22083199-22083221 CAGAGAAATCTCTAAGAAAAAGG - Intergenic
1005350724 6:24932712-24932734 CTGTGTAACCTCTAGGAGAAAGG + Intronic
1006881921 6:37347684-37347706 CAGTGGTATATCTAGGAAGCAGG + Intergenic
1007066112 6:38991779-38991801 CACTGTGATATCTAGGAGGAGGG - Intronic
1011058423 6:83232763-83232785 AAGTATAATCTCTAGGTCGAGGG - Intronic
1013823523 6:114183785-114183807 CTGTGTATTCTCTAATAAGATGG - Intronic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1016407212 6:143743190-143743212 CAGTCTAAATTCTAGGAAGAAGG + Intronic
1017240981 6:152168459-152168481 CAGTGTAATCTGTAAGGAGGAGG + Intronic
1021654167 7:22858580-22858602 CAGTGAAATCTATGGCAAGATGG + Intergenic
1022118342 7:27282601-27282623 GAATGTAATCTCTAGGTAAAAGG + Intergenic
1022364534 7:29698786-29698808 CAGTTTAATTCCTAGGAAGGTGG + Intergenic
1022696823 7:32714952-32714974 CAGTTTAATTCCTAGGAAGGTGG - Intergenic
1023206108 7:37751337-37751359 CAGTGTCATCTCTGCAAAGAAGG + Intronic
1026997486 7:74627632-74627654 CAGTGTAATCCCTGAGAAAATGG - Intergenic
1028098560 7:86792683-86792705 CTGTGTAAGCTCTATGAAGCAGG - Intronic
1029224994 7:99019591-99019613 CAGTGTCATCACTAGGTAGTTGG - Intergenic
1030302716 7:107990515-107990537 AAGTGAAATAACTAGGAAGATGG - Intronic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1033099115 7:138455610-138455632 CAGTTTGATCTCTGGGAAGCTGG - Intergenic
1034151956 7:148924059-148924081 CATGGTAACCTATAGGAAGAAGG - Intergenic
1034207649 7:149331481-149331503 CACCGTAATCTCCAGAAAGAAGG + Intergenic
1042692216 8:71513028-71513050 TAGTGTAATCTCTAAAAACAAGG + Intronic
1043262327 8:78218247-78218269 CAGTGTCATTTCTAGAAAGGGGG + Intergenic
1045505889 8:102778252-102778274 CACGGTAGTCACTAGGAAGATGG - Intergenic
1045845417 8:106629402-106629424 CAGTGTAAGTTCTATGAATAGGG + Intronic
1047993099 8:130307168-130307190 CAATGTACCCTCTATGAAGAAGG + Intronic
1051461898 9:17328047-17328069 CAGTGTGATTTCTAAGTAGAGGG - Intronic
1052558363 9:30049919-30049941 AAATGTAGTCTCTAGGATGAAGG - Intergenic
1052602391 9:30651769-30651791 CAGTGTAAACTCCAGAAAGAAGG - Intergenic
1053087025 9:35233959-35233981 CAGAGAACTCTCTAGGGAGAAGG - Intronic
1053381958 9:37655956-37655978 CAGTGAAATCCCTGGGATGAGGG - Intronic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1056199369 9:84259661-84259683 CAGTGTCAACTCTTGGAAAAAGG - Intergenic
1057318489 9:93989374-93989396 CAGTCTAATCCCTAGGCAAAAGG - Intergenic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1060882431 9:127127183-127127205 CAGTCTACTGTCTGGGAAGATGG - Intronic
1187198694 X:17113933-17113955 CACCTTAATATCTAGGAAGAAGG + Intronic
1188006429 X:25018704-25018726 GCGTCTAATATCTAGGAAGAGGG + Intergenic
1190905422 X:54722404-54722426 CAGTGTAAGCTCTATGAAGGTGG + Intergenic
1195976918 X:110536708-110536730 CAGTATTATCTCTAGGATGGGGG + Intergenic
1198252484 X:134893569-134893591 CAGTGTTAGCTCTAGGAGGGTGG - Intronic
1199168183 X:144702345-144702367 TATTGTGATCTCTAGGAAGAGGG - Intergenic
1200472425 Y:3601225-3601247 GAATGTAAATTCTAGGAAGAAGG - Intergenic