ID: 1031957379

View in Genome Browser
Species Human (GRCh38)
Location 7:127956148-127956170
Sequence TGTGCTAAGGATTGGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031957379 Original CRISPR TGTGCTAAGGATTGGGCATA TGG (reversed) Intronic
901220180 1:7579219-7579241 TGTCCAAAGGCTTGGGCATGAGG - Intronic
903376758 1:22871286-22871308 TGTGGTATGGATGGAGCATATGG - Intronic
906196072 1:43931561-43931583 TGTGCTAATGATTGGGGCTGGGG - Intergenic
908944111 1:69473538-69473560 AGAGTTAAGGATTGGGCATAAGG - Intergenic
909280964 1:73753157-73753179 AGTTCTAAGGAGTGTGCATAAGG + Intergenic
911051851 1:93678113-93678135 TGGGCTGAGGCTTGGGCATCAGG - Intronic
912040663 1:105385571-105385593 TGGGCTAAGAATTGGTCATAGGG - Intergenic
912843512 1:113059719-113059741 TGTGCTGAGGATGGGGACTAGGG + Intergenic
912971064 1:114283597-114283619 TGTGCTAAGTATTGGGAATGGGG - Intergenic
915307499 1:154989026-154989048 TGTGCTAGGTGTTGGGGATATGG + Intronic
916857772 1:168768648-168768670 AGTGGTAAGGAATGGGAATAGGG - Intergenic
917493985 1:175523633-175523655 TGTGCTAAGGATGGAGAAGAGGG - Intronic
919519053 1:198564405-198564427 TGTTATAAGCATTGGACATATGG + Intergenic
1064658104 10:17576806-17576828 TGCCCTAAGTATTGGGCAAAGGG + Intergenic
1067985593 10:51140339-51140361 TGTGCTAGGGATTAGGGGTAAGG - Intronic
1069775741 10:70926110-70926132 TGTGCCAGGCATGGGGCATAGGG + Intergenic
1069860501 10:71468250-71468272 AGTGTTAAGGATTTGGCTTAAGG - Intronic
1072512160 10:96138713-96138735 CGTTCTAAGCATTGGGAATATGG - Intronic
1073251418 10:102122028-102122050 TGTGCTTAGGATGGGGGATAGGG + Intergenic
1073428045 10:103468166-103468188 TGTGCTAAGCATTGGGCATATGG - Intergenic
1073618811 10:105025739-105025761 TCTGCTAAGGGCTGGGGATAAGG - Intronic
1075392332 10:122101364-122101386 TGTGCTAAGGACTGGGGACCAGG - Intronic
1081613601 11:44577911-44577933 TGGGCCAAGGACTGGGCACAGGG + Intronic
1082179372 11:49100047-49100069 TTTGGTAGGAATTGGGCATACGG - Intergenic
1083529593 11:63407587-63407609 TGTTTTAAGGATTAGGAATAAGG - Intronic
1083608199 11:63991636-63991658 TGTGCCAGGGATTTGGCACAGGG - Intronic
1087568561 11:99895081-99895103 AGTGCTAAAGGTAGGGCATAAGG + Intronic
1089584944 11:119504400-119504422 TGTGCTAAGGATAGGTGTTATGG + Intergenic
1094564080 12:31583933-31583955 AATGCTAAGGATCAGGCATATGG + Intronic
1094793207 12:33938838-33938860 TGTGATAATATTTGGGCATAGGG + Intergenic
1095104478 12:38215595-38215617 TGTGATAATATTTGGGCATAGGG + Intergenic
1095831641 12:46592799-46592821 TGAGTAAAGGATTTGGCATAAGG - Intergenic
1099853802 12:88138958-88138980 AGTACTAAGGACTGAGCATATGG - Intronic
1101502292 12:105315515-105315537 TGTGGTAAGGAATGTGCCTAAGG + Intronic
1105629870 13:22152495-22152517 TGTGCAAGGCATTGGGTATATGG + Intergenic
1108204220 13:48071936-48071958 TTGGCTTAGGATTGGGCTTAGGG + Intronic
1117505560 14:56399003-56399025 AGTGCTAAGGACTGGGAATTAGG + Intergenic
1120112720 14:80576887-80576909 TGTGCTAAGTAGTGGACATCCGG + Intronic
1120332278 14:83108762-83108784 GGTGCTAGGGATAGGGAATAAGG - Intergenic
1120841817 14:89092356-89092378 TGTGCTAGACATTGGGAATAAGG - Intergenic
1123786821 15:23682893-23682915 TGAGGTAAGGATGGGGCATAAGG - Intergenic
1125076772 15:35628495-35628517 TCTGCGAAGGACTGGGAATAAGG + Intergenic
1127227134 15:56943059-56943081 TCTGCCAAGGAGTGGGAATAAGG - Intronic
1127391659 15:58510122-58510144 GGTGCTAGGTACTGGGCATAGGG + Intronic
1127878097 15:63129287-63129309 TGTGTTAAGGACTTGGAATAAGG + Intronic
1128254699 15:66188124-66188146 TGGGGTAAGGATGGGGCATGGGG - Intronic
1130231758 15:82102587-82102609 TGTGCTAGGCATTGGGCTAAAGG + Intergenic
1130725209 15:86432099-86432121 TTTGCTAAGGACCTGGCATAAGG + Intronic
1130879895 15:88046051-88046073 GGTGCTGAAGATTAGGCATATGG - Intronic
1131859350 15:96636151-96636173 TGTGCTAGGGACTGAGGATATGG + Intergenic
1134099453 16:11441363-11441385 TGTGCTAAGTATTAGGAATATGG - Intronic
1134689900 16:16184398-16184420 TGTTCTAGGTATTGGGGATAGGG - Intronic
1135467437 16:22699301-22699323 TGTGCTAAGCACTGGAGATACGG - Intergenic
1141136431 16:81468612-81468634 TGTGCTAAGGGTTGGGAGTGTGG + Intronic
1141588446 16:85050812-85050834 TGTGCTAAGTGCTGGGCACACGG - Intronic
1142001556 16:87667191-87667213 TGTGCTCAGGACGGGGCAGAGGG - Intronic
1148012525 17:44494879-44494901 TGAATTAATGATTGGGCATAGGG - Intronic
1149027125 17:52040041-52040063 TGTGTGAAGGAGTGGGCAAATGG + Intronic
1149597732 17:57874170-57874192 TTTGCTGAGGAAGGGGCATATGG + Intronic
1149792906 17:59494726-59494748 CTTGGTAAGGATTGGGCATGCGG - Intergenic
1150659930 17:67066335-67066357 TGTGCAGAGGATTTGGCAAAAGG - Intergenic
1150849990 17:68695242-68695264 TGTGCTAAGGAGTGGGCAGCTGG + Intergenic
1152134490 17:78495791-78495813 AGTGCCAAGGAGTGGGCAGAGGG - Intronic
1153738188 18:8095075-8095097 GGTGCTAAGCATTGGGGATATGG + Intronic
1156157298 18:34318266-34318288 TGTGGCAAGTATGGGGCATAAGG + Intergenic
1156309405 18:35908643-35908665 TGCGCTAAGCACTGGACATAAGG + Intergenic
1156309723 18:35910787-35910809 TGTGCTAAGCACTGGACATAAGG + Intergenic
1157284673 18:46369575-46369597 TGTGTTAGGGAGTGGGAATAGGG - Intronic
1157414131 18:47488191-47488213 TGAGCTCAGGCTTGGCCATATGG - Intergenic
1165485478 19:36092903-36092925 TGTGCTAAGGGCAGGGCCTAGGG - Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1167750181 19:51374707-51374729 TGTGTTCAGGAATGGGAATAGGG - Intergenic
927446218 2:23164139-23164161 AGTGCTAAGGAATGGGGAGACGG + Intergenic
927797105 2:26059310-26059332 TGTGCTAGATATTGGGGATATGG + Intronic
927982897 2:27385923-27385945 TGTGCTCAGGATTGTATATAGGG - Intronic
929570505 2:43019875-43019897 TGTTCAAAGGATTTTGCATACGG - Intergenic
929571375 2:43025169-43025191 TGTGCTAAGGAAGGGGCAGGAGG - Intergenic
933759410 2:85663636-85663658 TGGGCTAAGGAGTGGGCAGTGGG + Intronic
937389216 2:121468765-121468787 TGGGCTTAGGATTGGGGTTAGGG - Intronic
941519985 2:166530045-166530067 GGTGCTAAAGATGGGGCACAGGG + Intergenic
942489309 2:176473961-176473983 TGAGCTAATGATGGGGCAGAGGG - Intergenic
942937473 2:181575374-181575396 TGTGCTAAGTACTGGGAAGAAGG + Intronic
943789866 2:191920180-191920202 TTGGCTAAGGACTGGGCATGTGG + Intergenic
1173939502 20:46897941-46897963 TGTGCAAAGGCTTGGGGAGAAGG + Intronic
1174582525 20:51582178-51582200 TGTGCTCTGGATTAGGAATAAGG - Intergenic
1175525028 20:59628013-59628035 TGGGCTAAGGAGGGGGCAGAAGG - Intronic
1179168136 21:38951348-38951370 TGTGCTCAGGACTGGGCTGAAGG + Intergenic
1180608458 22:17079630-17079652 TGTTCTAAGCACTGGGAATATGG + Intergenic
1183781712 22:40003159-40003181 TGTGCTAAGGCTGGGGAAGAGGG + Intronic
949897439 3:8778713-8778735 TCTGCTAAGGACTGGGAGTACGG - Intronic
950496784 3:13338640-13338662 TGTGCTCTGGATTGGACAGATGG + Intronic
951081104 3:18450817-18450839 TCTTTTAAGGATTGGGGATATGG + Intergenic
954853130 3:53619907-53619929 TGTGCTAAGCATTGGTAATATGG + Intronic
962743813 3:138382698-138382720 TGTGCTAAGAGTTGGGTGTAGGG - Intronic
962973847 3:140429245-140429267 TGTGCTAAAGGCTGGGGATACGG + Intronic
964092551 3:152893611-152893633 TGTGCAAAGGATGAGGTATAAGG + Intergenic
966964487 3:184976668-184976690 AGAGCTAATCATTGGGCATATGG - Intronic
966976423 3:185087641-185087663 TTTGCCAGGGACTGGGCATACGG + Intronic
973083442 4:46024770-46024792 TGAACTAAGGCTTGAGCATATGG + Intergenic
973735167 4:53864427-53864449 TGTACTAAAGATGGGGCCTACGG - Intronic
976185349 4:82437564-82437586 TGTGCTAAGCTGTGGGAATATGG + Intronic
976981860 4:91241839-91241861 TGTGCTAAGGAGGGGATATATGG + Intronic
979478534 4:121186629-121186651 TGTGCTAAGCATTGTACATATGG - Intronic
980477988 4:133344908-133344930 TGTGCTAAGGGTAGAGAATATGG + Intergenic
982469711 4:155773699-155773721 TTTGCTATGGATTGGACACAGGG - Intronic
982477633 4:155872737-155872759 TTTGCTTAGGATTGGGCTCAGGG - Intronic
984065842 4:175047147-175047169 TATTCTAAATATTGGGCATATGG - Intergenic
984159560 4:176234597-176234619 TGTGCTAGGTATTGAGGATATGG - Intronic
985662196 5:1162790-1162812 TGTGCACAGGGTTGGGCCTAGGG + Intergenic
987169957 5:15244388-15244410 TGTGCTCAGGACTGGGAATGTGG - Intergenic
987263352 5:16226026-16226048 TGTGCACAGGATGGGTCATAAGG + Intergenic
988140209 5:27228862-27228884 TGTGCTATGCATTAAGCATATGG + Intergenic
991528804 5:67593073-67593095 AGTGCTAAGTACTGGGGATATGG - Intergenic
991903638 5:71485797-71485819 TGTGATAAAGGTAGGGCATATGG + Intronic
992350433 5:75922884-75922906 TGTGTTAAGCACTGAGCATAGGG + Intergenic
993419528 5:87683705-87683727 TGTGTTAAGGATTGATCAGAAGG - Intergenic
993762579 5:91814525-91814547 TGTGGTAAAGAATGTGCATATGG - Intergenic
995676610 5:114669546-114669568 TGTGTTAGGAATTGGGCATGTGG - Intergenic
996016131 5:118535805-118535827 TTTGTTAAGGATTGTGCAAAAGG + Intergenic
998472110 5:142391481-142391503 TGTGAAAAGGATGGGGCAGAAGG + Intergenic
1000150963 5:158500574-158500596 TGTGCAAAGGCCTGGGCATAGGG + Intergenic
1000245489 5:159445592-159445614 TGTGCTAAGCATTGTGCTGAAGG + Intergenic
1001071219 5:168586953-168586975 TGTTCTAGGGATTAGGGATATGG + Intergenic
1004323368 6:14650985-14651007 TGTGCTAAGGATTAGAGATGGGG + Intergenic
1005311720 6:24565287-24565309 TGTACTAAGGAGTGGTCACAGGG - Intronic
1008360477 6:50611717-50611739 TGTGCTAAGGATTAGGAAAAGGG - Intergenic
1008601799 6:53103451-53103473 TGTGTTAAGTATGGGGCAGAAGG + Intergenic
1008990053 6:57591330-57591352 TGTGCTAAGAAAAGGCCATAAGG + Intronic
1011592768 6:88986285-88986307 TGTTCTAAGGACTGGAGATATGG - Intergenic
1012301659 6:97596275-97596297 TGTGATTGGGAGTGGGCATACGG + Intergenic
1013587275 6:111590908-111590930 TGTTCTAATCTTTGGGCATATGG - Intronic
1015969948 6:138733799-138733821 AGTTCTATGGATTGGGTATAGGG - Intergenic
1017172541 6:151471356-151471378 AGTGCTAAGGAGAGGGCAAAGGG - Intergenic
1017253484 6:152307449-152307471 TGTACTAAGGATAGAGTATATGG - Intronic
1018170035 6:161137311-161137333 TGTGCTCAGCACTGGGCATGGGG + Intronic
1019131435 6:169879823-169879845 TGTGCTGAGGATTTGCCATCTGG + Intergenic
1022586162 7:31614569-31614591 TGTTCTAAGGATCTGGTATATGG - Intronic
1024899526 7:54302810-54302832 TTTGCTCAGGATTGGGTATTTGG - Intergenic
1026070473 7:67114524-67114546 TGTACAGAGGATTGGGCTTAAGG + Intronic
1026439168 7:70428336-70428358 TGAGCAAAGGATTGGGCAGCTGG + Intronic
1026706426 7:72697754-72697776 TGTACAGAGGATTGGGCTTAAGG - Intronic
1031957379 7:127956148-127956170 TGTGCTAAGGATTGGGCATATGG - Intronic
1037724065 8:21468539-21468561 TGTGCTAAGTACTGGGGAGAGGG - Intergenic
1041472880 8:58230768-58230790 TGTGCCAAGCATTGGGCCTAAGG - Intergenic
1042345135 8:67719374-67719396 TGTGGTCAGGATTGGGGAAATGG + Intronic
1042782793 8:72510291-72510313 TGTTCTAAGTATTGCACATATGG + Intergenic
1042998524 8:74728583-74728605 CGTGCTAAGGATTAAGTATAGGG + Intronic
1044559915 8:93602868-93602890 TGTGCTCTGGATTTGGCATTAGG + Intergenic
1045262404 8:100588276-100588298 GGTGCTAAGCATTTGGGATAAGG + Intronic
1045501363 8:102746724-102746746 TGTTCTAAGCACTGGGCATGGGG - Intergenic
1048209090 8:132439970-132439992 TGTATTAAGGATTGAGCATCTGG - Intronic
1048615762 8:136073957-136073979 TGTGCTGAGAATTCTGCATATGG + Intergenic
1049913143 9:289718-289740 TGTGATATGGAGTGGGGATAAGG - Intronic
1051662783 9:19441334-19441356 TGTGCTCAGGGCTGGGCATGTGG - Intronic
1052054514 9:23888392-23888414 TGTGCTATGGATGGGGTTTATGG + Intergenic
1052659019 9:31404253-31404275 TGTGCTTAGGTTATGGCATATGG - Intergenic
1055956028 9:81774302-81774324 TGTGCTAAGCACTGGACATTTGG + Intergenic
1056188383 9:84160180-84160202 TTTACCAAGGATTGGTCATATGG - Intergenic
1057443351 9:95097455-95097477 TGTGGAAAGGAGTGGGCACAAGG + Intergenic
1057951235 9:99370415-99370437 TGTGCTAGGCACTGGGGATATGG - Intergenic
1058791488 9:108450198-108450220 TGTTCTAAGTACTGGGGATATGG + Intergenic
1058800308 9:108539141-108539163 TGTGCTAAGCACTGGGAACATGG + Intergenic
1059059860 9:111024105-111024127 TGTGGTATGCATTGTGCATATGG - Intronic
1062578649 9:137220196-137220218 TGTGCTCAGGCCTGGGCCTAGGG - Intergenic
1203769832 EBV:43985-44007 TGTGCTGAAGATGGGGCAGATGG + Intergenic
1187129107 X:16483864-16483886 TGTGCTAAGATTTGGGGATATGG - Intergenic
1187251797 X:17605618-17605640 AGTGCTTAGGATGGGGGATAGGG - Intronic
1188554560 X:31397335-31397357 TGTGCAAAGGACTGGACAAAGGG - Intronic
1189095181 X:38130838-38130860 TGAGCTAAGGACTGGGATTATGG - Intronic
1195739479 X:108049064-108049086 GGTGCTAAGAATTGGGAATCTGG + Intronic
1195741541 X:108069715-108069737 TGTGCTAAGCAATGGACATGGGG + Intronic
1197012308 X:121580828-121580850 TTTGCTTAGGATTAGGGATAGGG - Intergenic
1198098182 X:133400776-133400798 TGTGGTAGGCATTGGGTATAGGG + Intronic
1198126472 X:133649063-133649085 TGTGCCAAGCACTGAGCATAGGG - Intronic
1198700251 X:139389329-139389351 TGTGCTAAGGATAGAGCCTATGG - Intergenic
1199169796 X:144722189-144722211 TGGGCTCAGGATTGGGCTCAGGG + Intergenic
1200955044 Y:8936415-8936437 TGGTCTAAGAATTGGGCAGATGG - Intergenic
1202032051 Y:20586547-20586569 TGAGGTAAGGAATGGGAATAGGG + Intronic
1202111262 Y:21422780-21422802 TGGTCTAAGAATTGGGCAGATGG + Intergenic
1202199866 Y:22335169-22335191 TGGTCTAAGAATTGGGCAAATGG - Intronic
1202336047 Y:23811971-23811993 TGGGGTAAGGATTAGGAATAGGG + Intergenic
1202534719 Y:25858096-25858118 TGGGGTAAGGATTAGGAATAGGG - Intergenic