ID: 1031957472

View in Genome Browser
Species Human (GRCh38)
Location 7:127957057-127957079
Sequence CAGAACATTGAATAGTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031957472 Original CRISPR CAGAACATTGAATAGTAGAC TGG (reversed) Intronic
903144384 1:21361338-21361360 CAGAACATGGGATATCAGACAGG + Intergenic
906458344 1:46017925-46017947 CAGAAGATTGAGTAGTAAATAGG - Intronic
907215945 1:52864111-52864133 CAGAGCCTTGAAAAGTAGACAGG - Exonic
911701707 1:100960921-100960943 CAAAACAATTAATAGTAGAATGG - Intronic
912162799 1:107006882-107006904 CAGAACCTTGAAAAATACACTGG - Intergenic
916365533 1:164023061-164023083 CAGGACATTGGATACTTGACTGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
1063055901 10:2503899-2503921 CTGAACACTGAACAGTACACAGG + Intergenic
1067192838 10:44086178-44086200 AATAACATTGAATAGAAGAGGGG + Intergenic
1068133429 10:52924503-52924525 CAGAACATTGAATATTTTAAAGG - Intergenic
1069952546 10:72029498-72029520 CAGAACATTGGTTGGTAGGCTGG - Intergenic
1079141439 11:17812727-17812749 CAGTATAATGAAAAGTAGACTGG - Intronic
1084135297 11:67174439-67174461 CAGAAAATAGAATAGTGGAAAGG - Intronic
1085576172 11:77605752-77605774 AAGAACATTAAAAAGTAGCCAGG + Intronic
1087806329 11:102559177-102559199 CAGAACATAGAAGGGTAGAAGGG - Intergenic
1091866833 12:3846144-3846166 CAGAACATAGAAAAATAAACAGG - Intronic
1095335617 12:41021730-41021752 CAGTACACAGAAGAGTAGACTGG + Intronic
1097229360 12:57499919-57499941 CAAAACTTTACATAGTAGACAGG + Intronic
1099480671 12:83161995-83162017 AAGAATATTGAATAGTAGAAAGG + Intergenic
1099648733 12:85396205-85396227 CACAACATTGAATGGGAGAGGGG + Intergenic
1101608986 12:106273063-106273085 CAGAACATTGATCAGTGGAGAGG - Intronic
1104388915 12:128375055-128375077 CTGAACATTGCATAGTACACAGG - Intronic
1105908061 13:24834064-24834086 TGGAACATTGAAAAGTAGCCAGG + Intronic
1108249259 13:48548898-48548920 CATAACATAGTATAGTGGACTGG + Intergenic
1112191288 13:97180380-97180402 GAAAACATTGAATAGAAGAATGG + Intergenic
1114464549 14:22912084-22912106 CAGAATTTTGAACAGTAGAGTGG - Intronic
1117267710 14:54107309-54107331 CAGAACTTTTAACAGTTGACTGG - Intergenic
1117721196 14:58630450-58630472 CAGAACAATGAAAAGCAGAGGGG + Intergenic
1120527546 14:85594670-85594692 AGGAAAATTGAATAGGAGACGGG - Intronic
1121933449 14:97994581-97994603 CAGAACATTTAAAATTACACAGG - Intergenic
1125198027 15:37071094-37071116 AAGGACATTGAATAGCAGACTGG - Intronic
1126016112 15:44352614-44352636 CAGAAAAGTGAAGAGTAGCCAGG + Intronic
1130742642 15:86617476-86617498 CATACAATTGATTAGTAGACAGG - Intronic
1135349737 16:21718637-21718659 TAGAACAATGCCTAGTAGACAGG - Intronic
1137703028 16:50511078-50511100 CAGAAGATTGAATAGAATAGTGG - Intergenic
1140171935 16:72614335-72614357 CAGCACAATGAATAGAAAACAGG + Intergenic
1143764973 17:9131622-9131644 CACACCATTGCATAGTAGCCTGG - Intronic
1148433818 17:47665247-47665269 CAGAACATCAAATAGTTGATGGG - Intronic
1151036242 17:70804091-70804113 CAGAACCTTCTATAGTACACAGG - Intergenic
1151709285 17:75792207-75792229 CATTACATTAAATAGTGGACTGG + Intronic
1155964358 18:32021681-32021703 CAGATCATTGAATAGCAAAGCGG - Intronic
1156344895 18:36247907-36247929 AAGAACAGTGGATAGGAGACAGG - Intronic
1156863965 18:41868182-41868204 CAGAACCTTAACTAGGAGACTGG - Intergenic
1160310277 18:77783221-77783243 CAGAACCTCAAATAGTAGGCAGG - Intergenic
1166176949 19:41080817-41080839 CAAAAGCTTCAATAGTAGACTGG - Intergenic
926877940 2:17505683-17505705 CAGAAACTTGAAAAGTAAACTGG - Intergenic
930541221 2:52709309-52709331 CACCACACTGAATAGTAGAGGGG - Intergenic
931849983 2:66243362-66243384 CAGGACATTGAATCTTAAACAGG + Intergenic
931850926 2:66249730-66249752 CAGGACATTGAATCTTAAACAGG + Intergenic
934863669 2:97786845-97786867 GAGGACATCGAATAGTAGAACGG - Intronic
937588675 2:123587854-123587876 CACAACAATTAATAGTATACAGG - Intergenic
940495327 2:154420400-154420422 CAGAAGATTAAAGAGTACACAGG - Intronic
941511905 2:166422047-166422069 CAGAACAGTGACTAGGAAACAGG + Intronic
944969720 2:204978151-204978173 CAGAACAGGGCATAGAAGACTGG + Intronic
945159316 2:206872876-206872898 CAGAAAATTTCAGAGTAGACTGG - Intergenic
946633630 2:221699749-221699771 AAGATCATTGACTAGTAGATGGG - Intergenic
946773701 2:223115381-223115403 CAGAACATTGTATTCTTGACTGG + Intronic
1173284305 20:41656297-41656319 GAGAAAATTGAATAGTTAACTGG + Intergenic
1174899802 20:54487089-54487111 CAGAACTTTGATTATAAGACTGG + Intronic
1177477083 21:21637263-21637285 TAGAACAGAGAATACTAGACTGG - Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178457491 21:32769198-32769220 CAGACCATAGAATATTATACTGG + Intronic
951368221 3:21812119-21812141 CAGAACATGGAATATTCTACAGG + Intronic
951792562 3:26502404-26502426 CAGAACTTTGAACAATATACTGG + Intergenic
961951378 3:130752879-130752901 CAGAAAATGGAATATTAGCCTGG + Intergenic
962048627 3:131788618-131788640 GAAAACATTTAAAAGTAGACTGG - Intronic
962925851 3:139992790-139992812 CAGAAAATTGAGGAGTAGAAGGG + Intronic
964038306 3:152225974-152225996 CATCACAGTGAATATTAGACTGG - Intergenic
965507547 3:169533110-169533132 CAGAACATTGGATAATACAGTGG - Intronic
967705369 3:192643612-192643634 CAGAGCCTTGAAGAGTGGACAGG - Intronic
970305586 4:14728687-14728709 CAGATCATGGAATAATAGACTGG + Intergenic
972922078 4:43956395-43956417 TAGAACAAAGAATACTAGACAGG - Intergenic
973098978 4:46238361-46238383 CAGATCACTGAATATTAGCCTGG + Intergenic
973251945 4:48069665-48069687 CAGAACATTGATTAATACAATGG - Intronic
974426579 4:61750061-61750083 CAGAACATAGAATAGTGGCACGG - Intronic
974485346 4:62496856-62496878 AAGAACATTGAAAATTAGCCAGG - Intergenic
975699859 4:77053146-77053168 CAGAATATAGAATAGAAGAACGG - Intronic
976757667 4:88515893-88515915 CAAAACTTGGAATAGTGGACAGG + Intergenic
980076353 4:128297881-128297903 AAAAACATTGAATACTAGAAAGG + Intergenic
980643243 4:135606709-135606731 CAGAAATTTGAATTGGAGACTGG - Intergenic
981142454 4:141284733-141284755 CAGAACATTGGAAAGAATACTGG + Intergenic
981470928 4:145133773-145133795 CAGAACATAGAAAAATAAACAGG + Exonic
981690404 4:147501622-147501644 CAGAACATTGTATAATAAACAGG - Intronic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
983809141 4:172036666-172036688 TAGAACATTGATTAGGAGCCAGG + Intronic
983990714 4:174116243-174116265 CAGAAACTTGAATACTAGAAAGG - Intergenic
986546697 5:8905683-8905705 GAGGAACTTGAATAGTAGACTGG - Intergenic
988111646 5:26830439-26830461 CAGAACATTGAAAATTAGGTGGG - Intergenic
990643919 5:57822164-57822186 CAGACCCTTGAATACTAGTCAGG + Intergenic
990657928 5:57978343-57978365 GAGAACATACAGTAGTAGACAGG + Intergenic
990862792 5:60346540-60346562 CACAACCATGAATATTAGACTGG - Intronic
993218348 5:85056258-85056280 GAGAGCATTGAATAGCATACTGG - Intergenic
993558307 5:89369594-89369616 CAGAAAATTGAAGAGGAGATGGG + Intergenic
993987449 5:94614090-94614112 CATAAAATTGAATAGCATACAGG + Intronic
994961230 5:106605316-106605338 CAGAACCTTCAATATTATACAGG - Intergenic
997670465 5:135667105-135667127 CAGAACATGAAATAGGAGATTGG - Intergenic
998613949 5:143719257-143719279 AAGGACATTGAATAGAAGGCTGG - Intergenic
999320626 5:150612937-150612959 CAAAACATTAAATATTAGCCAGG - Intronic
1001462156 5:171925385-171925407 CAGAAAATTGAACAGTAGCCTGG - Intronic
1009751923 6:67886279-67886301 CAGAATAGTGAATTGTAGAAGGG + Intergenic
1009970169 6:70616936-70616958 AAGAACATGGACTACTAGACTGG + Intergenic
1010949292 6:82016087-82016109 AAGAACATTCAGTAGTAGGCAGG + Intergenic
1016323742 6:142876474-142876496 CAGAAGCTTCCATAGTAGACAGG + Intronic
1016879443 6:148896466-148896488 CAGAACAATGAATAGGAGCGTGG - Intronic
1017661037 6:156673196-156673218 CAGATTTTTGAATAGTAAACTGG - Intergenic
1023377375 7:39571022-39571044 CTGAACATTGAATACTTGTCAGG + Intronic
1026370938 7:69698480-69698502 AATAACATTAAATGGTAGACAGG - Intronic
1026693535 7:72571138-72571160 CAAAAAATTGAAAATTAGACAGG + Intronic
1030550962 7:110959059-110959081 CAGAACATTAAATGGAAGATTGG + Intronic
1031957472 7:127957057-127957079 CAGAACATTGAATAGTAGACTGG - Intronic
1038575360 8:28700244-28700266 AAGAAAAGTGAATAGGAGACGGG + Intronic
1038873423 8:31520906-31520928 CAGAAGATTGAATTGGAGATGGG - Intergenic
1039874524 8:41574371-41574393 CAGAACGTAGAATGGTAGAATGG + Intergenic
1043534765 8:81190207-81190229 CACAACATTGAAAATTGGACTGG - Intergenic
1046442321 8:114273468-114273490 AAGAACAGTGAATGGTATACGGG + Intergenic
1054953063 9:70874952-70874974 CAGAACACTTAATAGTAGTTAGG - Intronic
1058398592 9:104586660-104586682 CAGAGCATTGAATCATAGACTGG + Intergenic
1058817617 9:108699475-108699497 CAGAACATTGAAGATTGGAGAGG - Intergenic
1060314026 9:122491707-122491729 CAGTGCATTGAATAATAAACAGG + Intergenic
1189893317 X:45628286-45628308 CAGAACATAGAATGGTGGTCAGG + Intergenic
1190774375 X:53540897-53540919 CAGAACCTTGAAGAATAGTCAGG - Intronic
1192294110 X:69828751-69828773 AAACACATTGAATAGTAGTCAGG + Intronic
1192357832 X:70420442-70420464 GAGAACATAGAGTAGTAGTCTGG - Exonic
1193234269 X:79087370-79087392 CCAAACATTGAAAAGTACACAGG + Intergenic
1193956032 X:87863955-87863977 AGGAACATTGAAAAGCAGACTGG - Intergenic
1194506639 X:94742008-94742030 CAGAATCTTTAATAGTAGAATGG - Intergenic
1194906978 X:99589882-99589904 TAGAACAATGAATAGTATAAAGG + Intergenic
1198573630 X:137986181-137986203 CAGCATATTGGAGAGTAGACAGG - Intergenic
1200084470 X:153596831-153596853 CAGCACATTGAAAAGTGGGCTGG + Intronic