ID: 1031959622

View in Genome Browser
Species Human (GRCh38)
Location 7:127976890-127976912
Sequence GGTGGAGCCTGTCCCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031959622_1031959626 -1 Left 1031959622 7:127976890-127976912 CCTTTGCTGGGACAGGCTCCACC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1031959626 7:127976912-127976934 CTCCCCTACATGGTGTCTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 105
1031959622_1031959627 0 Left 1031959622 7:127976890-127976912 CCTTTGCTGGGACAGGCTCCACC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1031959622_1031959631 22 Left 1031959622 7:127976890-127976912 CCTTTGCTGGGACAGGCTCCACC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1031959631 7:127976935-127976957 GCTTCCCATTTCCTTCAGTCTGG No data
1031959622_1031959633 24 Left 1031959622 7:127976890-127976912 CCTTTGCTGGGACAGGCTCCACC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1031959633 7:127976937-127976959 TTCCCATTTCCTTCAGTCTGGGG No data
1031959622_1031959632 23 Left 1031959622 7:127976890-127976912 CCTTTGCTGGGACAGGCTCCACC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1031959632 7:127976936-127976958 CTTCCCATTTCCTTCAGTCTGGG 0: 1
1: 0
2: 2
3: 35
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031959622 Original CRISPR GGTGGAGCCTGTCCCAGCAA AGG (reversed) Intronic