ID: 1031959627

View in Genome Browser
Species Human (GRCh38)
Location 7:127976913-127976935
Sequence TCCCCTACATGGTGTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031959618_1031959627 16 Left 1031959618 7:127976874-127976896 CCGTGGAGGCAGGAAACCTTTGC 0: 1
1: 0
2: 1
3: 21
4: 188
Right 1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1031959622_1031959627 0 Left 1031959622 7:127976890-127976912 CCTTTGCTGGGACAGGCTCCACC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031959627 Original CRISPR TCCCCTACATGGTGTCTTGA GGG Intronic