ID: 1031960836

View in Genome Browser
Species Human (GRCh38)
Location 7:127988408-127988430
Sequence GTGGACTAGCAACGTAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031960828_1031960836 27 Left 1031960828 7:127988358-127988380 CCCTACTTCGGCTTCCTACTCTT 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1031960836 7:127988408-127988430 GTGGACTAGCAACGTAACAAAGG No data
1031960829_1031960836 26 Left 1031960829 7:127988359-127988381 CCTACTTCGGCTTCCTACTCTTG 0: 1
1: 0
2: 1
3: 4
4: 162
Right 1031960836 7:127988408-127988430 GTGGACTAGCAACGTAACAAAGG No data
1031960832_1031960836 13 Left 1031960832 7:127988372-127988394 CCTACTCTTGTCGTGCTAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1031960836 7:127988408-127988430 GTGGACTAGCAACGTAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031960836 Original CRISPR GTGGACTAGCAACGTAACAA AGG Intronic
No off target data available for this crispr