ID: 1031961421

View in Genome Browser
Species Human (GRCh38)
Location 7:127993574-127993596
Sequence TGGGATGGCCGCAGTTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031961416_1031961421 -4 Left 1031961416 7:127993555-127993577 CCTGGAGCTGAGCCACCGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 253
Right 1031961421 7:127993574-127993596 TGGGATGGCCGCAGTTGAACTGG No data
1031961413_1031961421 24 Left 1031961413 7:127993527-127993549 CCACAGTGCACGACAGTGCAGGA 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1031961421 7:127993574-127993596 TGGGATGGCCGCAGTTGAACTGG No data
1031961411_1031961421 25 Left 1031961411 7:127993526-127993548 CCCACAGTGCACGACAGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1031961421 7:127993574-127993596 TGGGATGGCCGCAGTTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031961421 Original CRISPR TGGGATGGCCGCAGTTGAAC TGG Intronic
No off target data available for this crispr