ID: 1031962257

View in Genome Browser
Species Human (GRCh38)
Location 7:128000654-128000676
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031962257_1031962262 14 Left 1031962257 7:128000654-128000676 CCATTGCACCTGGCAAGTGAACT No data
Right 1031962262 7:128000691-128000713 TTGGAGTGTCTTCAGGCTTCAGG No data
1031962257_1031962260 -5 Left 1031962257 7:128000654-128000676 CCATTGCACCTGGCAAGTGAACT No data
Right 1031962260 7:128000672-128000694 GAACTTTAATGTGGTATGTTTGG No data
1031962257_1031962261 7 Left 1031962257 7:128000654-128000676 CCATTGCACCTGGCAAGTGAACT No data
Right 1031962261 7:128000684-128000706 GGTATGTTTGGAGTGTCTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031962257 Original CRISPR AGTTCACTTGCCAGGTGCAA TGG (reversed) Intronic