ID: 1031962258

View in Genome Browser
Species Human (GRCh38)
Location 7:128000662-128000684
Sequence CACATTAAAGTTCACTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031962258_1031962261 -1 Left 1031962258 7:128000662-128000684 CCTGGCAAGTGAACTTTAATGTG No data
Right 1031962261 7:128000684-128000706 GGTATGTTTGGAGTGTCTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 202
1031962258_1031962262 6 Left 1031962258 7:128000662-128000684 CCTGGCAAGTGAACTTTAATGTG No data
Right 1031962262 7:128000691-128000713 TTGGAGTGTCTTCAGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031962258 Original CRISPR CACATTAAAGTTCACTTGCC AGG (reversed) Intronic