ID: 1031962262

View in Genome Browser
Species Human (GRCh38)
Location 7:128000691-128000713
Sequence TTGGAGTGTCTTCAGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031962257_1031962262 14 Left 1031962257 7:128000654-128000676 CCATTGCACCTGGCAAGTGAACT 0: 1
1: 0
2: 1
3: 20
4: 245
Right 1031962262 7:128000691-128000713 TTGGAGTGTCTTCAGGCTTCAGG No data
1031962258_1031962262 6 Left 1031962258 7:128000662-128000684 CCTGGCAAGTGAACTTTAATGTG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1031962262 7:128000691-128000713 TTGGAGTGTCTTCAGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031962262 Original CRISPR TTGGAGTGTCTTCAGGCTTC AGG Intronic
No off target data available for this crispr