ID: 1031964156

View in Genome Browser
Species Human (GRCh38)
Location 7:128015376-128015398
Sequence AGATTAGCGCTGATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031964156_1031964158 -9 Left 1031964156 7:128015376-128015398 CCAGCCTTCATCAGCGCTAATCT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1031964158 7:128015390-128015412 CGCTAATCTGTTTTTGAAAATGG 0: 1
1: 0
2: 1
3: 21
4: 256
1031964156_1031964164 30 Left 1031964156 7:128015376-128015398 CCAGCCTTCATCAGCGCTAATCT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1031964164 7:128015429-128015451 TTTGCTCCCTAAGTATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031964156 Original CRISPR AGATTAGCGCTGATGAAGGC TGG (reversed) Intronic
900288669 1:1914554-1914576 AGATTGACGCTGACGAGGGCAGG - Intergenic
910922562 1:92364854-92364876 AGCTTAACTCTGATCAAGGCAGG + Intronic
915657519 1:157373989-157374011 AGATTAGGGCTGAGGAAAGATGG + Intergenic
923815731 1:237376018-237376040 AGTTTAATTCTGATGAAGGCAGG - Intronic
924103708 1:240630139-240630161 AGATAAGGGCTGATTAAAGCAGG - Intergenic
1065376544 10:25048999-25049021 AGAATAGCGATTAAGAAGGCTGG + Intronic
1068249462 10:54418470-54418492 AGATTAGAGTGAATGAAGGCTGG - Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1071764404 10:88646172-88646194 AAATTAGGGCTGATAAAGGGAGG + Intergenic
1072114137 10:92353075-92353097 GTATTAGGGCTCATGAAGGCCGG + Exonic
1076292107 10:129353524-129353546 AGATAAATGCTGTTGAAGGCAGG + Intergenic
1081893189 11:46562277-46562299 AGCTTAGCGCATGTGAAGGCCGG + Intronic
1083125230 11:60559034-60559056 AGGTCAGCACGGATGAAGGCTGG - Intergenic
1089124282 11:116165397-116165419 AGGTGAGCAATGATGAAGGCTGG - Intergenic
1097278287 12:57827782-57827804 ACATTAGGCCTGATGAAGGATGG + Intronic
1106173833 13:27311051-27311073 AGCTTAGTGCTGCTGAAGCCTGG - Intergenic
1109099121 13:58157303-58157325 AGATTCTGGCTGATGAAGGAGGG + Intergenic
1114440310 14:22741421-22741443 AGATTAGAGCTGAGGAATGATGG + Intergenic
1122943182 14:104992448-104992470 AGATTGGCCCTGGTGAAGACAGG + Intronic
1138128059 16:54455034-54455056 AGAAGAGAGCTGAAGAAGGCAGG - Intergenic
1139623575 16:68166456-68166478 AGCCTAGCACTGAAGAAGGCTGG - Intronic
1140691066 16:77484328-77484350 AGGTTAGCTCTTATCAAGGCTGG - Intergenic
1144074400 17:11703933-11703955 AGATTGACTCTGATCAAGGCCGG - Intronic
1148733476 17:49851559-49851581 AGATGAGGGCGGATGAGGGCAGG + Intergenic
1148799081 17:50211763-50211785 AGAATAGAGCTGAGAAAGGCTGG + Intergenic
1158512915 18:58107378-58107400 GGATTAGAACTGATGGAGGCAGG + Intronic
1167218586 19:48182474-48182496 AGCTTGACGATGATGAAGGCGGG - Exonic
932169682 2:69542547-69542569 AGTTTTGCACTGATGCAGGCGGG + Exonic
932475898 2:72005652-72005674 AGTTTACGGCTGATGCAGGCAGG + Intergenic
933195498 2:79384791-79384813 AGATTAGAGATCATGAAGGTGGG - Intronic
937029154 2:118723737-118723759 AGCTTAGCTCTGAGGAAGGCTGG - Intergenic
938697323 2:133846026-133846048 AGAATAGCACTGATGAAGAAAGG - Intergenic
947084968 2:226440966-226440988 AGATGAACACTGATGAAGTCTGG - Intergenic
1173529333 20:43756615-43756637 AAAATAGCACAGATGAAGGCTGG + Intergenic
1174285329 20:49468795-49468817 TGACCAGCGCTGAGGAAGGCTGG + Intronic
1175402256 20:58707370-58707392 AGAGCAGCTCTGATGAAGGCGGG - Intronic
1179177775 21:39021487-39021509 AGATTGGGACTGAGGAAGGCTGG + Intergenic
1183009756 22:34935174-34935196 AGATAAGCTCAGATGAAAGCAGG + Intergenic
1183124962 22:35768305-35768327 AGAATAGTGCTGATGCAGACAGG - Exonic
1184510267 22:44929373-44929395 AGCTTGGGGCTCATGAAGGCGGG - Intronic
1184655676 22:45940927-45940949 AGATCAGTGATGATGAAGTCGGG + Intronic
950694855 3:14690956-14690978 AGGTGAGGGCTGAGGAAGGCGGG - Intronic
952918475 3:38267450-38267472 ACGTTAGGGCTGGTGAAGGCTGG - Intronic
954980174 3:54738765-54738787 AGATAAGGGCTGAAGAAGGTAGG - Intronic
955556388 3:60142165-60142187 TGATTTGAGCTGATAAAGGCTGG - Intronic
962553209 3:136517171-136517193 TGATAAGCACTGATGAAGACTGG + Intronic
966329278 3:178793150-178793172 AAATTAGTATTGATGAAGGCTGG - Intronic
983248328 4:165314925-165314947 AGATGAGCGCTGATGGAGGGGGG - Intronic
985275112 4:188230849-188230871 AGATCAGGGCTGCTGCAGGCTGG + Intergenic
986686867 5:10282484-10282506 AGATTAGCGTAAAAGAAGGCCGG + Intronic
989105870 5:37862416-37862438 AGACTAGGGCTGCTGAATGCAGG - Intergenic
990591039 5:57265437-57265459 AGATTAGGGATGATGACGGATGG - Intergenic
991975714 5:72182158-72182180 AAAATAGAGGTGATGAAGGCCGG - Intronic
997991451 5:138547593-138547615 AGAGTAGCCAAGATGAAGGCAGG + Intergenic
998438275 5:142132953-142132975 AGATTGAGGCTGATGAAGGTAGG + Intronic
1003694766 6:8392859-8392881 AGATTAGGGCTGGAGAGGGCTGG - Intergenic
1004877940 6:19974682-19974704 AAATTAGAGTTAATGAAGGCTGG - Intergenic
1013028931 6:106311614-106311636 AGAATAGTGCTGAGGAAGCCAGG + Intronic
1020281334 7:6651779-6651801 AGCTTAGAGCTGACAAAGGCAGG + Intronic
1021929426 7:25564790-25564812 AGAGAAGAGCAGATGAAGGCTGG - Intergenic
1024531587 7:50398166-50398188 AGGTTATGGCTGATGATGGCTGG - Intronic
1028242859 7:88442561-88442583 AGATTAGTGCTGAAGAAAGTGGG - Intergenic
1031492082 7:122401728-122401750 AGATTGGGGTAGATGAAGGCAGG + Intronic
1031964156 7:128015376-128015398 AGATTAGCGCTGATGAAGGCTGG - Intronic
1032951328 7:136917620-136917642 ACATTAGCGCTGGTGAAAGCTGG - Intronic
1035878881 8:3221953-3221975 AGGCTGGCGCTGATGAGGGCTGG - Intronic
1041605289 8:59774810-59774832 AGACTAGAGTTGATGAAGACTGG - Intergenic
1051457623 9:17278243-17278265 AGAGTAGAGATGATGAAGACTGG + Intronic
1053867877 9:42459066-42459088 AAATTAGCCCTGATGCAGACTGG - Intergenic
1057310332 9:93938973-93938995 AGATAGGAGCTGATGGAGGCAGG + Intergenic
1058147265 9:101425822-101425844 AGATTAGGGGTGATGAAGACAGG - Intronic
1186799304 X:13077311-13077333 AAGTTAGCTCTGAGGAAGGCCGG - Intergenic
1186841628 X:13490036-13490058 AAATTAGCACTGATGAAAGATGG - Intergenic
1194915036 X:99695837-99695859 AGATACAGGCTGATGAAGGCTGG - Intergenic
1198220476 X:134596377-134596399 AGAGTAGCTCTGATGGAGACAGG + Intronic