ID: 1031966578

View in Genome Browser
Species Human (GRCh38)
Location 7:128031733-128031755
Sequence GCTGCGGCCGCCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1422
Summary {0: 1, 1: 6, 2: 121, 3: 316, 4: 978}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031966578_1031966589 21 Left 1031966578 7:128031733-128031755 CCGGCGGCGGCGGCGGCCGCAGC 0: 1
1: 6
2: 121
3: 316
4: 978
Right 1031966589 7:128031777-128031799 CGTCGCCGCCCGCCGCTGCCCGG No data
1031966578_1031966591 28 Left 1031966578 7:128031733-128031755 CCGGCGGCGGCGGCGGCCGCAGC 0: 1
1: 6
2: 121
3: 316
4: 978
Right 1031966591 7:128031784-128031806 GCCCGCCGCTGCCCGGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031966578 Original CRISPR GCTGCGGCCGCCGCCGCCGC CGG (reversed) Intronic
900109675 1:1000234-1000256 GCTCCGGGCGCGGCCTCCGCGGG + Intergenic
900214062 1:1471853-1471875 GCCGCCGCCGCTACCGCCGCCGG - Exonic
900221611 1:1512237-1512259 GCCGCCGCCGCTACCGCCGCCGG - Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
901019718 1:6249576-6249598 GCTGCGCCCGCCGCCCCCGACGG - Exonic
901242599 1:7704151-7704173 ATTGCAGACGCCGCCGCCGCAGG + Intronic
901332778 1:8423753-8423775 GCTGGGGCCGCCGCTGACGGGGG + Intronic
901381546 1:8878092-8878114 GCTGCGGCCCCCTCCCCCACCGG - Intronic
901628975 1:10639030-10639052 GCCGCCTCCGCCGCCGCCTCGGG + Exonic
901629012 1:10639210-10639232 GCCGCCGCCGCCGCCGCAGCTGG - Exonic
902304075 1:15524155-15524177 GCCGCAGCCGGCACCGCCGCAGG + Exonic
902413933 1:16227980-16228002 GCTGCGACCCCCGCGGCGGCGGG - Intergenic
902577393 1:17386847-17386869 GCTGCGGCCGTGGCTGCCCCTGG - Intronic
902606078 1:17570069-17570091 GCTGTGGCCGCCTCCTCCCCAGG + Intronic
902786816 1:18738319-18738341 GCCGGGGCTGCCGCTGCCGCTGG - Intronic
902823180 1:18955955-18955977 GCTGAGGCCGTGCCCGCCGCCGG + Exonic
902861693 1:19251555-19251577 GCCGCGGGCTCCGCCTCCGCGGG + Exonic
902923133 1:19679152-19679174 GCTGCCGCTGCCCCTGCCGCCGG + Exonic
903115521 1:21176259-21176281 GCCGCCGCTGCTGCCGCCGCCGG + Exonic
903115634 1:21176590-21176612 GCCTCCGCCGCCGCCGCCGCCGG + Intronic
903324741 1:22563450-22563472 GCCGCCGCCGCCGCCGCCCCGGG - Intergenic
903652324 1:24929785-24929807 CTTGCCGCCGCCGCCGCCGCAGG + Exonic
903907432 1:26696589-26696611 CGTGGGGCCGCCGCAGCCGCTGG + Exonic
903907458 1:26696666-26696688 GCCGGGCCCGCCGCCGCTGCCGG - Exonic
903907486 1:26696765-26696787 GCTGCCGCCACCGCCGCCGCCGG - Exonic
903907688 1:26697433-26697455 GCTGCGGCGGCGGCCGCCTCGGG + Exonic
904006594 1:27366327-27366349 GCTGCGGGGGCGGCCGCGGCCGG + Exonic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904499994 1:30908204-30908226 GGAGAGGCCGCCCCCGCCGCTGG - Intronic
904500199 1:30908782-30908804 TGCGCCGCCGCCGCCGCCGCCGG + Intergenic
904642016 1:31938144-31938166 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
904837745 1:33349915-33349937 GCTCCCGCGGCCGCCTCCGCCGG + Intronic
904837749 1:33349918-33349940 CCCGCGGCCGCCTCCGCCGGGGG + Intronic
905066887 1:35192246-35192268 GCTGCGGCCGCCGGGCCCGCCGG + Exonic
905067066 1:35192737-35192759 GCAGCCGCCGCCACCGCCGCAGG - Exonic
905137071 1:35808166-35808188 GCCGCCGCCGCCGCCGCCAACGG - Exonic
905422732 1:37859542-37859564 GCTGCTGCTGCCGCCGTTGCCGG - Exonic
905806982 1:40884379-40884401 GCGGCTGCCGCCGCCGCCCGCGG + Intergenic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906262530 1:44405410-44405432 GCCGCCGCCGCTGCCTCCGCCGG + Exonic
906365389 1:45205890-45205912 GCTCCGGCCGGCTCCGCCCCCGG - Exonic
906480950 1:46198470-46198492 GCCGCCGCCGCCGCTGCCGCGGG + Intronic
906590982 1:47023916-47023938 GCAGCAGCCGCTGCCTCCGCAGG - Exonic
906637014 1:47416489-47416511 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
906650358 1:47508451-47508473 CCTGCGGCCGCGGCGGCCCCAGG - Intergenic
906650359 1:47508451-47508473 CCTGGGGCCGCCGCGGCCGCAGG + Intergenic
906960919 1:50419098-50419120 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907010628 1:50959889-50959911 GCCACCGCCGCCGCCGCCGCCGG + Exonic
907038334 1:51236348-51236370 GCTGCTGCCCCCGCCGACGCCGG - Exonic
907136228 1:52142062-52142084 GCTCCTGCCGCCGGCGCCGCTGG - Intergenic
907178887 1:52553014-52553036 GCCGTCGCCGCTGCCGCCGCTGG + Intronic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
907884040 1:58576998-58577020 GCAGCGGCCGCCGGGGCCGTCGG + Exonic
908355782 1:63323842-63323864 GCGGCGGCGGCCGGCGCCGCGGG + Exonic
908355808 1:63323923-63323945 GCCGCGGCCGCCGCCGCTGCCGG - Exonic
908401131 1:63774054-63774076 GCCGCCACCGCCGCCGCCGAGGG + Exonic
908527586 1:65002690-65002712 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
910450104 1:87335400-87335422 GCTGCGGCCTCGGGCGGCGCCGG - Intronic
910676414 1:89821084-89821106 GCTGCCGCTGCCGCCGCCCGTGG + Exonic
910759000 1:90717596-90717618 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
910788000 1:91021665-91021687 TGAGCGGCGGCCGCCGCCGCGGG - Intronic
910788012 1:91021706-91021728 GCGGCGGCCGCGGCGGTCGCTGG - Intronic
911017219 1:93346084-93346106 GCCGCTGCCGCTGCCGCTGCTGG - Exonic
911219737 1:95234169-95234191 GCCGCAGCCGCCGCCTCCACCGG - Exonic
912174723 1:107141355-107141377 GCTGCTGCGGCCGCCGCCCGAGG + Intronic
912174724 1:107141358-107141380 GCTGCGGCCGCCGCCCGAGGCGG + Intronic
912305243 1:108560270-108560292 GCAGCGGCCCCGGCCGCGGCCGG + Exonic
912363478 1:109113884-109113906 GCCATGGCAGCCGCCGCCGCTGG - Intronic
913300893 1:117367469-117367491 GCGGCGGCGGCCGCGGCGGCTGG + Exonic
913521361 1:119648159-119648181 GCGGCGGCTGCAGCGGCCGCTGG + Intergenic
913565673 1:120069836-120069858 GCGGCGGCCCCCGGGGCCGCTGG - Intergenic
913615719 1:120558170-120558192 GCCGCCGCCGCCGCCGCCTCGGG - Intergenic
913632456 1:120723718-120723740 GCGGCGGCCCCCGGGGCCGCTGG + Intergenic
913632521 1:120723955-120723977 GCCGCCGCCTCAGCCGCCGCCGG - Intergenic
913995883 1:143651756-143651778 GTTGCAGCCGCAGCCCCCGCAGG - Intergenic
914286269 1:146229210-146229232 GCGGCGGCCCCCGGGGCCGCTGG - Intergenic
914293634 1:146298121-146298143 GCTGCTCCGGCCGCCGCCGTGGG - Intergenic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
914428603 1:147600197-147600219 GCCGCCGCTGCCGCCGCCGGGGG + Intronic
914492431 1:148160694-148160716 GCGGCAGCCGCAGCCCCCGCAGG - Intergenic
914547297 1:148679952-148679974 GCGGCGGCCCCCGGGGCCGCTGG - Intergenic
914554678 1:148748904-148748926 GCTGCTCCGGCCGCCGCCGTGGG - Intergenic
914574557 1:148952732-148952754 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
914730392 1:150364664-150364686 GCCGCCGCCGCCGCCGCCAGAGG + Intronic
914730409 1:150364722-150364744 ACTGCTGCCTCCGCCGCCGCCGG - Exonic
914869162 1:151458950-151458972 CCCGCGGCCGCCCCTGCCGCGGG + Intronic
914919538 1:151838216-151838238 GCAGCCGCCGCCGCCGCTCCCGG + Exonic
915041523 1:152971899-152971921 GCTGCTGCCGCTGCTGCTGCTGG - Exonic
915070348 1:153261155-153261177 GCCGCCCCCGCCCCCGCCGCCGG - Exonic
915070480 1:153261638-153261660 TCCGCCGCTGCCGCCGCCGCCGG - Exonic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
915246320 1:154558532-154558554 GATGCAGCAGCCGCAGCCGCAGG - Exonic
915326077 1:155081934-155081956 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
915495964 1:156282762-156282784 GCCGCAGCCGCCGCCGCCACCGG + Exonic
915599625 1:156914030-156914052 GCTGGGGTTGCCGCCGCCTCTGG - Exonic
916065509 1:161132648-161132670 GCCGCCGCCGCCGCGGCCGTGGG + Exonic
916179322 1:162070133-162070155 CCTGCAGCCGCCGCCTCCGAAGG + Exonic
916761289 1:167820169-167820191 GCTGCGGCCGCCGCGGCATTCGG - Intronic
918487671 1:185045998-185046020 GCTGGGGCCCCCGCCCCCGGAGG - Intronic
919101786 1:193105264-193105286 GCTGCGGCAGCTGCGGCCTCTGG - Intronic
919101979 1:193106515-193106537 GCTGCGGCAGCTGCGGCCTCTGG - Intergenic
919712284 1:200739615-200739637 GCCGCCGCCGCCGCCGCTCCCGG - Exonic
920309967 1:205043241-205043263 GCCGCGGCCGCCGCCGCACCCGG + Exonic
920367478 1:205455705-205455727 GCTGCGTCAGCCGCCGCCCTAGG - Intronic
920655221 1:207869225-207869247 GCAGCGCCCGACGCGGCCGCTGG - Intergenic
920705008 1:208244297-208244319 GCCGCCGCCGCCGCCACCGCGGG - Exonic
920705045 1:208244434-208244456 GCTGGGGCCGCGCCCGCTGCTGG + Intergenic
921155070 1:212432961-212432983 GCGGCGGCGGCTGCGGCCGCTGG + Exonic
921155071 1:212432970-212432992 GCTGCGGCCGCTGGCAGCGCTGG + Exonic
921189850 1:212699678-212699700 GCTGCGGCTGCGGCTGCGGCTGG + Exonic
921556139 1:216601073-216601095 GCTGCTGCCGCCCGCGCTGCCGG - Intronic
921909080 1:220528284-220528306 GGATCGGGCGCCGCCGCCGCTGG + Intronic
922315082 1:224434686-224434708 GCTGCGGCGGCGGCGGCGGCGGG + Intronic
922696813 1:227735061-227735083 GCTGGGGCAGCCGGCGGCGCTGG - Exonic
922753738 1:228082873-228082895 CCTGTCGCCGCCGCCGCCGCGGG - Intronic
923056193 1:230426793-230426815 TCGGCAGCAGCCGCCGCCGCGGG - Intergenic
923141212 1:231162621-231162643 GCTGCAGCCGGCGGCGGCGCTGG + Intronic
923141485 1:231163793-231163815 CTTGCAGCCGCCGCCTCCGCTGG - Exonic
923163416 1:231337390-231337412 GCCGGAGCCGCCGCCGCCTCTGG - Exonic
923191777 1:231626902-231626924 GCTCACGCCGCCGCCGCCGGCGG - Exonic
923490263 1:234478351-234478373 GCCGCGGGCGCGGTCGCCGCCGG + Exonic
923506403 1:234609608-234609630 GCGGCCGCCGCCGCCGCTGGTGG - Intergenic
923506404 1:234609611-234609633 TTTGCGGCCGCCGCCGCCGCTGG - Intergenic
923674042 1:236065013-236065035 GCTGCTGCTGCCGCTGCTGCTGG - Exonic
923684194 1:236142592-236142614 ACGGCCGCCGCCGCCCCCGCGGG - Exonic
924172419 1:241356684-241356706 GCCGCGGCGGCCGCCGGAGCCGG + Intronic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
924624500 1:245687836-245687858 GCTGCTGGTGCCGCTGCCGCTGG - Exonic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
924854001 1:247857679-247857701 GCAGCGCCCGCAGCCCCCGCCGG - Intronic
1063367295 10:5499090-5499112 GCTGGGGCAGCCGCTGCCGCAGG - Exonic
1063429621 10:5977405-5977427 GCTCCGGCCGCCGGCGACGCGGG - Exonic
1063443148 10:6089394-6089416 CCTCCGCCCGCCGCCGCCTCTGG + Exonic
1063664100 10:8051507-8051529 GATGCCGCCGCCGCCGCCGCAGG - Intergenic
1064103043 10:12479532-12479554 GCTGCTGCCGCCGCTGCTGTGGG + Intronic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064230945 10:13528946-13528968 GCCGCCGCCGCCGCGACCGCAGG - Intronic
1064274199 10:13891772-13891794 CCCGCCGCCGCCCCCGCCGCGGG + Intronic
1064442983 10:15370672-15370694 GCTGCTGTCGCCGCTGCGGCGGG - Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1064645442 10:17454593-17454615 GCTGCCGCCGCCGCCGCGCGGGG + Intergenic
1064662062 10:17616933-17616955 GCTGTCGCCGCGGCCACCGCCGG - Intronic
1064981872 10:21173845-21173867 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1065214940 10:23439716-23439738 GCGCCCGCCTCCGCCGCCGCCGG + Exonic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1065925999 10:30434243-30434265 GCTTCTGCCGCTGCCGCCGCCGG + Exonic
1066429268 10:35336652-35336674 GCCGCCGTCGCCGCAGCCGCCGG + Intronic
1066429329 10:35336849-35336871 GCCGCCGCCGCCGCCGCCCATGG + Intronic
1066464802 10:35641985-35642007 CAAGCCGCCGCCGCCGCCGCCGG + Exonic
1068669540 10:59709622-59709644 GCTGCGGCCCCGGCCCCTGCCGG + Exonic
1068669568 10:59709708-59709730 CATGTGGCCGCCGCCGCTGCGGG - Exonic
1068889925 10:62138200-62138222 GCTGCAACCTCCGCCCCCGCAGG + Intergenic
1068910524 10:62374420-62374442 GCTGCTGCAGCCGCCGCCTCCGG - Exonic
1069019186 10:63466135-63466157 GCCGCCGCCGCCGCCGCCTCTGG - Intergenic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1071086821 10:81875229-81875251 CCCGAGCCCGCCGCCGCCGCCGG + Intergenic
1071086887 10:81875422-81875444 GCTGCGGCGGCGGCAGCGGCGGG + Exonic
1071611721 10:87038198-87038220 GCTGCTGCTGCCACTGCCGCTGG - Intergenic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1071997520 10:91162878-91162900 AGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1072102262 10:92240068-92240090 TCAGCAGCCGCCGCCGCCTCAGG - Exonic
1072102314 10:92240281-92240303 GCTGCTGCCGCTGCTGCTGCTGG + Exonic
1072409071 10:95183876-95183898 CCTGCCGCCGCCGCCGCCCCGGG + Intergenic
1073137375 10:101227438-101227460 GCCGCAGCCGCCGCCACCGCCGG + Exonic
1073196437 10:101695146-101695168 GCCGCCACCGCCGCCGCCCCGGG + Exonic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1073465487 10:103692663-103692685 GCAGCGGCCGCCGCAGCCCGGGG + Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074483933 10:113854833-113854855 GATGCGGCCGCCGGGCCCGCGGG - Exonic
1074503100 10:114043895-114043917 GCTGGAGCCGCTGCCGCTGCTGG - Intergenic
1074503105 10:114043913-114043935 GCCGCCGCCGCCGCTGCTGCTGG - Intergenic
1074722120 10:116272606-116272628 GCTGCCGCCGCCGCCACCGAGGG - Intronic
1074814503 10:117134309-117134331 GCAGCCGCCGCCGCCGCCCCGGG - Exonic
1074865721 10:117543424-117543446 TCGGCCGCCGCCGCCGCCGCCGG + Exonic
1074995504 10:118754516-118754538 GATGGGGCCGCAGCCACCGCCGG - Exonic
1075129492 10:119726067-119726089 GCCGCTGCCGCCGCCGCTGCCGG + Intergenic
1075802168 10:125160404-125160426 GCCGCCACCGCCACCGCCGCCGG - Intronic
1076116944 10:127907387-127907409 GCTGCCTCGGCCGCTGCCGCGGG + Intronic
1076554208 10:131311518-131311540 GCCGCCGCCGCCGCCGCCCTGGG - Exonic
1076554221 10:131311593-131311615 GCAGCTGCCGCCGCCGCCGCTGG + Exonic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076848994 10:133083839-133083861 GCTGCGGCTGCTGCCTCCGTAGG - Intronic
1077074669 11:694947-694969 GCGGCGGCCGCGGCCGCGGCAGG - Exonic
1077298101 11:1835371-1835393 GCTGCTGCTGCCGCCGCCACAGG + Exonic
1077637747 11:3855324-3855346 GCTGCTGTCGCCGCCGCCGCAGG + Intronic
1077916063 11:6612140-6612162 GCGGAGGCCGGCGCCGCCTCGGG + Exonic
1078053477 11:7987401-7987423 GCTGGGGCCGCCGCCGGGACTGG - Exonic
1078053501 11:7987497-7987519 GTTGCAGCCGCTGCTGCCGCAGG - Exonic
1078527230 11:12110462-12110484 GCTGTCACCGCCGCTGCCGCCGG - Intronic
1079163259 11:18013243-18013265 GCTGCGAGCGCCGCCGGGGCGGG - Intergenic
1079361950 11:19777111-19777133 GCTGGGGCCGCGGCGGCCGAGGG - Intronic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1079689406 11:23403535-23403557 CGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1080012418 11:27472304-27472326 GCTGCGGCCGCCTCCCGCGCCGG + Exonic
1081574302 11:44309744-44309766 GCTGCGGCTGCGGCGGCGGCTGG + Exonic
1081636754 11:44726960-44726982 GCAGCTGCCGCCGGCGTCGCGGG + Intronic
1081700078 11:45147105-45147127 GCTGCCGCCGCCGCGGGAGCCGG + Intronic
1081705612 11:45180759-45180781 GCTGCGGCCGGGGCGGGCGCGGG - Intronic
1081773923 11:45665259-45665281 GCTGCCGCCGCCGCCACCCGCGG - Exonic
1081831549 11:46120165-46120187 GCTGCGGCTGCTGACGCTGCCGG - Intronic
1081863510 11:46347470-46347492 GCCGCTGCCGCCGCCGCTCCAGG - Intronic
1082787517 11:57324917-57324939 GCCGCCGCCGCCGTCACCGCGGG + Intronic
1083207495 11:61161402-61161424 GCCGTCGCCGCCGCCACCGCGGG + Exonic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083618446 11:64037326-64037348 GCTGCCTCCCCCGCGGCCGCCGG - Intronic
1083751863 11:64765488-64765510 GCTCGGGCCATCGCCGCCGCGGG + Exonic
1083890239 11:65592340-65592362 CCGGCGTCCGCCGCCGCCCCGGG + Exonic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1083970350 11:66070518-66070540 GCTGCCGCCCCCGGCGCCTCCGG - Exonic
1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG + Intergenic
1084086755 11:66858476-66858498 GCTGCGGCGGCTGGCGCGGCCGG + Exonic
1084128701 11:67118228-67118250 GCGCCGGCCGCCACCGCCCCCGG + Intergenic
1084129037 11:67119341-67119363 GCCGCCGCCGCCGCCGCTGCCGG - Intronic
1084193280 11:67508597-67508619 GCTGCCGTCGCCGCTGCCACCGG + Exonic
1084395034 11:68903941-68903963 GCCGAGGCCATCGCCGCCGCCGG - Exonic
1084546849 11:69818951-69818973 CCTGCAGCCGCCGCCGCCGCGGG - Exonic
1085043981 11:73343010-73343032 ACTGCGGCTGCCGCCGCGGCCGG + Intronic
1085208066 11:74749048-74749070 GCCGCCGCTGCCGCCGCGGCCGG + Exonic
1085208068 11:74749051-74749073 GCCGCTGCCGCCGCGGCCGGAGG + Exonic
1085284629 11:75351733-75351755 GCCGCCGCCGCCCCCGCCCCCGG + Intergenic
1085346043 11:75768778-75768800 GCCGCGGCTGCCGCCTCTGCTGG + Exonic
1085353391 11:75815231-75815253 GCTGCCGCCGTTGCCGCCGCTGG - Exonic
1085423206 11:76381063-76381085 TTTACCGCCGCCGCCGCCGCTGG + Intergenic
1085561271 11:77474210-77474232 GCAGCCGCCGCCGCCGCGCCGGG - Intronic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1086887837 11:92224977-92224999 GCCGCCGCCGCCGCCGCCGGGGG - Intergenic
1086887840 11:92224980-92225002 GACGCCGCCGCCGCCGCCGCCGG - Intergenic
1086887856 11:92225058-92225080 GCTGCGGCGGCAGCAGCCGGGGG + Intergenic
1087634547 11:100687594-100687616 CCAGCGCCCGCCGCGGCCGCCGG + Intergenic
1088677252 11:112206301-112206323 GCTGCCGCCCCTGCCGCCCCAGG - Intronic
1088868982 11:113875531-113875553 TCTCCCGCCGCAGCCGCCGCCGG + Exonic
1088893162 11:114060034-114060056 GCTGCAGCCGTCGCCGCCACCGG + Intronic
1089046101 11:115503552-115503574 ACAGCGGCCGCCCCCCCCGCGGG + Intronic
1089180509 11:116580128-116580150 GCTGCGCCCGCCGGGTCCGCGGG - Intergenic
1089432706 11:118436681-118436703 GCCGCGGCCGCCACAGCCGGGGG - Exonic
1089494867 11:118902806-118902828 ACTGCCGCCGCCGCCACCCCCGG - Exonic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1089673680 11:120074446-120074468 GCTGCGGACTCCGCCTCAGCAGG + Intergenic
1089700249 11:120240227-120240249 TTCCCGGCCGCCGCCGCCGCGGG - Intronic
1089738339 11:120564704-120564726 GGCACGGCCGCCGCCGCAGCAGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090788472 11:130069993-130070015 ACCGCGGCCGCCGCAGCCACGGG + Exonic
1090832337 11:130428217-130428239 GCTGCTGCTGCTGCTGCCGCTGG - Exonic
1091201963 11:133787902-133787924 GCTGCGCGCGCAGCAGCCGCCGG + Intergenic
1091434163 12:460343-460365 GAGGCGGCCGCCGCCAGCGCGGG - Exonic
1091558583 12:1594166-1594188 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
1091705154 12:2688658-2688680 GCTGCTGCCCCCGCCACCGGGGG - Exonic
1091759458 12:3077383-3077405 GCCGCCGCCGCCGCCGCCAGCGG - Exonic
1092659500 12:10723035-10723057 GCCGCGGCGGCCGCCTCCGTCGG + Exonic
1092727677 12:11500712-11500734 ACCGCTGCCGCCGCCACCGCCGG + Intronic
1092810370 12:12266802-12266824 GGGGCGGCCGCCGCAGCGGCAGG + Exonic
1093435340 12:19129743-19129765 GCTGCCGCCGCGGCTGCCGAGGG - Intronic
1094041032 12:26122310-26122332 GCGGCTGCCGCGGCTGCCGCCGG + Exonic
1094041036 12:26122316-26122338 GCCGCGGCTGCCGCCGGGGCGGG + Exonic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1094653433 12:32399394-32399416 GCCGCCGCCGCCGCCTCCTCCGG - Intergenic
1095049498 12:37543693-37543715 GCTGCAGCCTCCGCGGCAGCTGG - Intergenic
1095271584 12:40225051-40225073 GCTGTGGCCGGCGCCCCTGCCGG + Intronic
1095752803 12:45729688-45729710 GCCGCCGCCGCCGCCACCGCCGG + Exonic
1096191340 12:49622235-49622257 CCCGCAGCCGCCGCCGCGGCAGG - Intronic
1096460878 12:51821008-51821030 GCTGCGCCCGGCGCCGCCGAGGG - Intergenic
1096466186 12:51848683-51848705 GCGGCTGCTGCGGCCGCCGCGGG + Intergenic
1096466187 12:51848686-51848708 GCTGCTGCGGCCGCCGCGGGCGG + Intergenic
1096491363 12:52014902-52014924 GCTGCCGCCCCCGCCGCCCCCGG + Exonic
1096495421 12:52037063-52037085 GCTGCGTCGGCCGCCGCCGCCGG + Intronic
1096848157 12:54419084-54419106 GCTGCTGCCGCCGCCACCCAGGG - Exonic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097057428 12:56258302-56258324 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1097107674 12:56634961-56634983 GCCGCCGCCGCCGCCGCCTGCGG - Intronic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097264419 12:57737513-57737535 GCCACCGCCGCCGCCGCCGGGGG - Exonic
1097264423 12:57737516-57737538 GCCGCCACCGCCGCCGCCGCCGG - Exonic
1097264608 12:57738119-57738141 GCGGCCGCGGCCGGCGCCGCCGG - Exonic
1097267565 12:57755076-57755098 GTCTCCGCCGCCGCCGCCGCCGG + Exonic
1097648138 12:62260606-62260628 GCTGCCCCGGCGGCCGCCGCCGG - Intronic
1097648140 12:62260609-62260631 GCGGCGGCCGCCGGGGCAGCGGG + Intronic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1098123824 12:67269639-67269661 GCCGCCGCCGCCGCCGCCACTGG - Exonic
1098161212 12:67649240-67649262 GCAGCGGCCGCCCGCGCCACAGG - Intronic
1098255489 12:68611257-68611279 GGAGCAGCCGCCGCCGCCGCGGG + Intronic
1098426059 12:70366535-70366557 GGCGCTGCCGCCGCCGCCGCCGG + Exonic
1098426062 12:70366538-70366560 GCTGCCGCCGCCGCCGCCGGGGG + Exonic
1098550369 12:71755133-71755155 GCTGCGGCCGGCGGCGGCGGCGG + Exonic
1099133521 12:78864792-78864814 GCTGCCGCTGCCGCTGCTGCAGG - Exonic
1099202160 12:79690200-79690222 GCTGCCGCCGAGGCCGCTGCTGG + Exonic
1100309183 12:93378274-93378296 GCTGCTCCGGCCGCCGCCGTGGG - Exonic
1100632292 12:96400594-96400616 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
1100823891 12:98457028-98457050 GCTGCTGCTGCCGCTGCTGCTGG - Intergenic
1101592984 12:106139460-106139482 GATACGGCCGGGGCCGCCGCGGG + Exonic
1101716958 12:107319886-107319908 GCGGCGGCCGCGGCGGCCGGCGG - Exonic
1101716959 12:107319889-107319911 ACTGCGGCGGCCGCGGCGGCCGG - Exonic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1102136956 12:110583271-110583293 GCGGCGGCGGCCGCTGCAGCCGG - Exonic
1102197154 12:111033966-111033988 GCCGCCGCCGCCGCCGCCAACGG - Intergenic
1102248343 12:111368991-111369013 GCCGCCGCCGTCGCCGCCACCGG - Exonic
1102254047 12:111405993-111406015 GCGGCCGCCGTCGCCACCGCGGG - Exonic
1102853861 12:116277232-116277254 GGCCGGGCCGCCGCCGCCGCCGG + Exonic
1103074147 12:117968845-117968867 GCAGTAGCCGCCGCAGCCGCGGG - Intronic
1103074155 12:117968901-117968923 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1103308823 12:119988987-119989009 GATGCGCCAGCCGCCTCCGCAGG + Intergenic
1103308947 12:119989454-119989476 GCTGCTGCTGCTGCCGCCGCCGG - Intergenic
1103348284 12:120265500-120265522 GCTGAGGCCGGGGCCGCCGAGGG + Intronic
1103407701 12:120687347-120687369 GCTGCTGCTGCTGCTGCCGCCGG + Exonic
1103433025 12:120904103-120904125 GGAGCCGCCGCCGCCGCCGCGGG - Exonic
1103521248 12:121537911-121537933 GCCGCCGCCGCCGCCGCCGAGGG - Intronic
1103534760 12:121626825-121626847 GCCGGAGCCGCCGCCGCAGCGGG + Exonic
1103566287 12:121817452-121817474 GCGGCGGCCGGCGCGGCCTCTGG + Exonic
1103708807 12:122895862-122895884 GCCGCGGTCGCCTCCGCCTCCGG + Intronic
1103954253 12:124567590-124567612 GCCACCGCCGCCGCGGCCGCCGG - Intergenic
1104444713 12:128823861-128823883 GCGGCGGCCGCGGCGGCGGCTGG - Exonic
1105011855 12:132761617-132761639 GCGGCCGCCGCCCCCGCCTCAGG - Exonic
1106036915 13:26051742-26051764 GCGGCGGCCGCGGCTGCTGCTGG + Intergenic
1106157492 13:27171777-27171799 GCCGCTGCCGTCGTCGCCGCCGG + Exonic
1106322965 13:28659274-28659296 GCTGCCGCCGCCGCCGCCACCGG - Intronic
1106517089 13:30465194-30465216 GCCGCCGCCGCCGCCGCGACCGG + Intronic
1106720077 13:32427766-32427788 GCTGGGGCCGGGGCCGCGGCAGG + Intronic
1106735833 13:32586910-32586932 GCCGCCGCCGCCGCCCCGGCCGG - Intronic
1107123420 13:36819457-36819479 GCCGCGGCCGCCACCGAGGCTGG - Exonic
1107467835 13:40665902-40665924 GCGGCCGCCGCGGCCGCCACCGG - Exonic
1107534076 13:41311277-41311299 GGAACCGCCGCCGCCGCCGCTGG + Exonic
1107548963 13:41457735-41457757 CCTGCGGCCGCGGCGGCCGCGGG - Exonic
1107548964 13:41457735-41457757 CCCGCGGCCGCCGCGGCCGCAGG + Exonic
1107851391 13:44576474-44576496 GCAGCGGCCGCCGACGCGGCGGG - Exonic
1108373416 13:49792536-49792558 GCCGCCGCCGCCGCAGCCGCAGG - Exonic
1108541494 13:51451731-51451753 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1110219625 13:73059372-73059394 GCCCCAGCCGCCGGCGCCGCAGG + Exonic
1110573049 13:77026868-77026890 CCTGCAGCCGCCGCCGTCCCCGG - Exonic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1111396083 13:87671885-87671907 GCTGCAGCCGCCGCCTTCGCTGG + Intergenic
1111951275 13:94711388-94711410 GCGGCGGCCGCCGCCGCCGGGGG - Exonic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112050621 13:95641776-95641798 GCTGTGGCCGCCGCCGCCGCGGG - Exonic
1112208193 13:97346728-97346750 CCTGCGGCCCCGGCCACCGCGGG - Intronic
1112216313 13:97434303-97434325 TCAGTTGCCGCCGCCGCCGCCGG + Exonic
1112505033 13:99970403-99970425 GCCGCCGCCGCCACCGCCCCCGG - Exonic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112505099 13:99970639-99970661 GCGGCGGCCGCAGCAGCGGCCGG - Exonic
1112505231 13:99971112-99971134 GCTGCCGCCGCCGCCACTGTTGG + Exonic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1113082773 13:106535336-106535358 GCAGCGCCCGCCGCCCGCGCCGG - Intergenic
1113200787 13:107866359-107866381 GCTGCTGCCGCTGCTGCTGCTGG + Exonic
1113200987 13:107867317-107867339 GCCGCCGCCGCCGCTGCCGCAGG + Intergenic
1113378132 13:109782945-109782967 GCAGCCGCCGCCACCGCCGCCGG - Exonic
1113378630 13:109784815-109784837 GCGGCGGCTGCGGCGGCCGCGGG - Exonic
1113379005 13:109786313-109786335 CCTGCGGCCGCTGCCTCCTCGGG + Exonic
1113397567 13:109962802-109962824 GCTGCTGCTGCCACAGCCGCCGG + Intergenic
1113656100 13:112068502-112068524 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1113656163 13:112068724-112068746 GCGGCCGCTGCTGCCGCCGCCGG - Exonic
1113737652 13:112689943-112689965 CCCGCGGCCGCAGCCCCCGCCGG - Intergenic
1113976962 13:114234970-114234992 GCAGCCGCCGCCGCCGCCCCAGG - Exonic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1114866200 14:26598002-26598024 GCTGCCGCCGCCGCCGCTGCCGG + Intergenic
1115028399 14:28767498-28767520 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1115119938 14:29927448-29927470 GCGGCAGCTGCCGCCGCCACGGG + Exonic
1115120102 14:29927970-29927992 GCAGCGGCCGCAGTGGCCGCAGG + Intronic
1115203022 14:30874274-30874296 GCTGCCGCCGTCGGGGCCGCCGG + Intergenic
1115320817 14:32077368-32077390 GTCGCTGCCGCCGCCACCGCCGG + Exonic
1115399318 14:32939416-32939438 GCCGCCGCCTCCGCCGCCGAGGG + Intronic
1115610754 14:35046590-35046612 GCTGCGGCCGCCGCGGCATTCGG + Exonic
1116657928 14:47674746-47674768 GCTCCGCTCGCCGCCGCCGCCGG - Exonic
1117119601 14:52553175-52553197 GCCGCTGCCGCCCCCGCAGCCGG + Exonic
1117251860 14:53946863-53946885 CCTGGTGCCCCCGCCGCCGCCGG + Intergenic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1117803050 14:59464694-59464716 TCGGCGCCTGCCGCCGCCGCGGG - Exonic
1118186504 14:63543000-63543022 CGTGAGGCCGCCGCCGCCACCGG - Exonic
1118339099 14:64879826-64879848 GCCGCCGCCGCCGCCACCCCCGG - Exonic
1118388903 14:65280198-65280220 GCAGCTGCCGCCACCGCCGAGGG - Intergenic
1118607699 14:67515404-67515426 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1118748349 14:68789897-68789919 GCTGCCACCGCCGCTGCCACCGG - Exonic
1118849300 14:69572290-69572312 GCTCCGCCCGCTCCCGCCGCAGG + Exonic
1118849483 14:69573096-69573118 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1119702231 14:76762879-76762901 GCTGCGGCCACCGCCCCCTCTGG + Exonic
1119802375 14:77457527-77457549 GCGCCAGCCTCCGCCGCCGCTGG + Exonic
1119821038 14:77616452-77616474 GCCGCAGCCGCAGCCGCCGCCGG - Exonic
1121617009 14:95319974-95319996 GTCGGGGCCGCCCCCGCCGCGGG + Intergenic
1121690899 14:95876580-95876602 GCTGCGGTCGCGGTCGCCGCTGG + Intergenic
1121690917 14:95876662-95876684 GCTACGGCCACCGTGGCCGCCGG + Intergenic
1121711048 14:96039448-96039470 GCTGCTGCCGCTGCCGCTGCGGG - Exonic
1121828892 14:97033272-97033294 GCTGCGGGATCCGCCGCCCCGGG + Intergenic
1122130691 14:99603312-99603334 GCTGCCGCCGCTGCCCGCGCTGG + Exonic
1122130813 14:99603928-99603950 GCCGCCGCCGCCGTCGCCGCGGG + Exonic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122226837 14:100285392-100285414 GCAGGGTGCGCCGCCGCCGCCGG + Intergenic
1122228305 14:100292314-100292336 GCTGTGCCCGCCGCCCCTGCGGG - Exonic
1122231201 14:100306983-100307005 CCGGAGGCCACCGCCGCCGCGGG - Intergenic
1122399164 14:101457464-101457486 ACAGCGGCCGCCCGCGCCGCCGG - Intergenic
1122418454 14:101561234-101561256 ACTCCGGCAGCCGCTGCCGCTGG - Intergenic
1122445013 14:101761777-101761799 GCCGCCGCCGCCGCCGCCCGGGG - Exonic
1122445018 14:101761786-101761808 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1122470746 14:101964489-101964511 GCTGCGGCGGCTGCGGCCGGCGG + Intergenic
1122582116 14:102777541-102777563 GCGGCCGCCGCGGCTGCCGCCGG - Exonic
1122582117 14:102777544-102777566 GCGGCAGCCGCGGCGGCCGCCGG + Exonic
1122952285 14:105051666-105051688 GTCGGGGCCGCCGCCGCCGGAGG - Exonic
1122975374 14:105168678-105168700 ACCGCCGCCGCCGTCGCCGCCGG - Exonic
1122976946 14:105174629-105174651 GGCGCAGCCGCGGCCGCCGCCGG - Intronic
1123059304 14:105587284-105587306 CCTGCTGCCGCCGCCGTCGGAGG - Intergenic
1123083636 14:105707515-105707537 CCTGCTGCCGCCGCCGTCGGAGG - Intergenic
1124109364 15:26772621-26772643 GCCCAGGCCGCCGCCGCCGTGGG + Intronic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124584468 15:30991954-30991976 GCTGCCGCCGTGGCCCCCGCAGG - Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124922315 15:34038918-34038940 GCCGCCTCCGCCGCCGCCTCTGG + Exonic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125200738 15:37099013-37099035 GCCGCCGCCGGGGCCGCCGCTGG - Intronic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1125626900 15:41116194-41116216 AAAGTGGCCGCCGCCGCCGCCGG - Exonic
1125674247 15:41494060-41494082 GTCGCTGCGGCCGCCGCCGCGGG + Exonic
1125916577 15:43493124-43493146 GCTGTCGCCACCGCCGCCACCGG + Exonic
1126406820 15:48331170-48331192 GCTGCGGGCGGTGCCGCCCCAGG + Intronic
1126436851 15:48645597-48645619 GCAGCCGCCGCCGCCTCCTCGGG - Exonic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1127165777 15:56243818-56243840 GCGGCGGCCGCGGCGGCGGCGGG - Intergenic
1127225119 15:56919391-56919413 GCGGCGGCGGCCGCAGACGCGGG + Intronic
1127417563 15:58771847-58771869 GCTGAGGCCGCCGGCGCTGCTGG - Exonic
1127488177 15:59438207-59438229 GGTGCGGCGGCCGCTGGCGCTGG - Exonic
1127632674 15:60841358-60841380 GCTGTGGCCGCGGCAGCCACAGG - Intronic
1127789916 15:62390559-62390581 GCTGCCGCCGCCGCTGGCTCCGG - Intronic
1127789918 15:62390565-62390587 TCAGCCGCTGCCGCCGCCGCTGG - Intronic
1127982697 15:64046314-64046336 GCCGCGGTCGCGGCCGCGGCAGG + Intronic
1128161018 15:65422905-65422927 GCTTCGGCCGCCGCCGCGGGGGG + Exonic
1128582753 15:68820492-68820514 GCTGCCGCCGCCGCTGCCCTTGG - Intronic
1129016720 15:72474866-72474888 GCCGCCGCCGCCGCCACCGCCGG - Exonic
1129260767 15:74365984-74366006 GGGGCCGCCGCCGCCTCCGCGGG + Intronic
1129348284 15:74938174-74938196 GCCGTAGCCCCCGCCGCCGCCGG - Intergenic
1129530651 15:76261630-76261652 GCTGCTGCCGCCACAGCAGCTGG - Intronic
1129675977 15:77632639-77632661 GCCGCCGCCGCCTCTGCCGCTGG + Intronic
1130261135 15:82355266-82355288 GCAGCCGCTGCTGCCGCCGCCGG + Intergenic
1130261138 15:82355269-82355291 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130280097 15:82513749-82513771 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130280100 15:82513752-82513774 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130295951 15:82647325-82647347 GCCGCGACCGCCGCCGTCGTGGG + Intronic
1130411699 15:83653723-83653745 GACGCCGCCACCGCCGCCGCCGG - Intergenic
1130471472 15:84229935-84229957 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130471475 15:84229938-84229960 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130478966 15:84344506-84344528 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130478969 15:84344509-84344531 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130492801 15:84443622-84443644 GCAGCCGCTGCTGCCGCCGCCGG + Intergenic
1130492804 15:84443625-84443647 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130593766 15:85234562-85234584 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130593769 15:85234565-85234587 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1131431747 15:92393908-92393930 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1131827148 15:96331074-96331096 GCTGCCGCTGCTGCCGCCGCCGG - Exonic
1131827172 15:96331169-96331191 GCCCGGGCCGCCGCTGCCGCCGG - Exonic
1132579939 16:680179-680201 GTGGCGGCCGCCGCCGAGGCGGG + Intronic
1132683531 16:1153245-1153267 GCCGCCGCCGTCGCCTCCGCCGG + Exonic
1132872666 16:2122706-2122728 TCTGCTGCCGCCGCAGCCGCTGG - Intronic
1132877960 16:2148665-2148687 GCCGCCGCCGCCGCCGCCAGGGG + Exonic
1132889533 16:2196877-2196899 GCTGGGGACGCGGCCGCCGGGGG + Intergenic
1132896765 16:2232948-2232970 GCTGTGGACGCAGCCGCCACTGG + Intronic
1133136716 16:3717433-3717455 GCTGCGGGCGCCGGCGCTGGCGG - Exonic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1133216192 16:4293924-4293946 GCTGCGGCCGCCAGCGCATCAGG + Intergenic
1133346145 16:5071888-5071910 GCTGCTGCCGCTGCTGCTGCTGG + Exonic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1133801590 16:9090303-9090325 GCTGCGGGCGACGCTGCCTCTGG + Intergenic
1135296536 16:21283932-21283954 GCCGCCGCCTCCGCCGCTGCGGG - Intronic
1135712492 16:24729666-24729688 GCCGACACCGCCGCCGCCGCAGG - Intergenic
1135712551 16:24729911-24729933 GCCTCTGCTGCCGCCGCCGCGGG - Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1135970338 16:27067472-27067494 GCTGCTGCCGCTGCCGCTGCCGG - Intergenic
1136003542 16:27313781-27313803 GCTGTCCCCGCCGCCGCCGCCGG - Intronic
1136110887 16:28063192-28063214 GCCGCCGCCGCCACCGCCTCGGG - Exonic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136366143 16:29810094-29810116 GCTGCCGCTGCCGCCGCCATTGG - Exonic
1136414741 16:30096224-30096246 GCTGCTGCCGCCGCTGCGGCGGG + Intronic
1136498774 16:30659473-30659495 GCTTCGGGCCCCGCCGCCTCCGG + Exonic
1136546530 16:30958014-30958036 GCCGCCGCCGCCACCGCTGCGGG + Intronic
1136627628 16:31471948-31471970 GGTGTGGCCGCCTCCGCGGCAGG + Intronic
1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG + Intergenic
1137412932 16:48244637-48244659 GCGCCGCCCGCCGCCGCCGCGGG - Intronic
1137655258 16:50153553-50153575 GCCGCCGCCGCCGCCGCCTCAGG - Intronic
1137655310 16:50153794-50153816 GCTGCTGCCGCTCCCGCCGGTGG - Exonic
1137668623 16:50266503-50266525 GCTGCTGCCGCTGCCGGAGCAGG + Exonic
1137708027 16:50548667-50548689 GCGGCGGCAGCCGCGGCGGCGGG - Intronic
1138105595 16:54285836-54285858 GCTGCGGCCGCCGCCGCCCAAGG - Exonic
1138105630 16:54285964-54285986 GCTGCCGCCGCTGCCGCCAGCGG + Exonic
1138179321 16:54931409-54931431 GCGGCGGCGGCGGCGGCCGCGGG - Exonic
1138185838 16:54976996-54977018 GCCGCCGCCGCCGCCGCCACTGG + Intergenic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1138360747 16:56425437-56425459 GCCGCCGCCGCCGCCGCGCCGGG + Exonic
1138889900 16:61129045-61129067 GCTGGGGCCGGCGGCGCTGCCGG + Intergenic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139459423 16:67110025-67110047 GGTGCTGCTGCCGCTGCCGCCGG + Exonic
1139528108 16:67528815-67528837 GCTGTCGCCGCCGCAGGCGCCGG - Intronic
1139528110 16:67528821-67528843 GCTGCCGCTGTCGCCGCCGCAGG - Intronic
1139615364 16:68085386-68085408 GTCGCCGCCACCGCCGCCGCGGG - Intronic
1139615419 16:68085631-68085653 GCTGCCGCCGCCGCCGCCTGAGG + Intronic
1140187424 16:72787737-72787759 ACTGCCACCGCCGCCGCCGCCGG + Exonic
1140187425 16:72787740-72787762 GCCACCGCCGCCGCCGCCGGTGG + Exonic
1140222987 16:73057859-73057881 GCTGCCGCGGCCGCCACCGCTGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1140223266 16:73058752-73058774 GCTGCGGCCGCCTCCCGCCCCGG - Intronic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141054706 16:80804385-80804407 GCCGCCGCCGCCGCTGCTGCCGG - Intergenic
1141079202 16:81035952-81035974 GGAGCCGCCGCCGCCGCCTCGGG + Exonic
1141128310 16:81416949-81416971 GCTGCTGCTGCTGCTGCCGCCGG - Intergenic
1141430587 16:83968696-83968718 GCTCCGGGAGCCGCCGCAGCAGG + Exonic
1141531372 16:84648823-84648845 GGAGGGGCCGCCGCCCCCGCAGG + Intronic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141608600 16:85169314-85169336 GCCTCGGCCCGCGCCGCCGCCGG + Intergenic
1141660169 16:85437191-85437213 CCTGCGGACGCCTCCGCCGCCGG + Intergenic
1141682597 16:85553294-85553316 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
1141682599 16:85553297-85553319 GCCGCCGCCGCCGCTGCCGGCGG + Intergenic
1141830749 16:86508896-86508918 GCTCGGCCTGCCGCCGCCGCGGG - Intergenic
1141840107 16:86568526-86568548 GCAGGCGCCGCCGCCCCCGCCGG + Exonic
1141959020 16:87392351-87392373 GCCGCAGCAGCCGCCGCCCCCGG + Exonic
1142161089 16:88558092-88558114 GCTGCAGCCGCCTGCCCCGCAGG - Intergenic
1142188384 16:88705863-88705885 GGAGCGCCCGCCGCAGCCGCCGG + Intronic
1142336163 16:89490573-89490595 GCTCCCGCCGCAGCCGCCGCTGG - Intergenic
1142547551 17:715097-715119 GCTGCGGTTGGCGACGCCGCAGG - Intronic
1142560583 17:806763-806785 GCTGCGGCCACCAGCACCGCGGG + Intronic
1142631446 17:1229012-1229034 GCTGCGGCCGCCGCCCCCCGGGG + Intronic
1143202676 17:5123123-5123145 GCGGCGGCAGCGGCCGGCGCTGG + Intronic
1143477649 17:7211789-7211811 GCTGCGGCGGCCGCGGCAACTGG + Intronic
1143510802 17:7394227-7394249 GCTGCGCCCGGCGCCGGCCCAGG + Exonic
1143539792 17:7562169-7562191 GGCGGGGCCGCCGCCGTCGCCGG + Exonic
1143548499 17:7614555-7614577 GCTGCTGCAGCCGCCGCCGGGGG - Exonic
1143548502 17:7614558-7614580 ACTGCTGCTGCAGCCGCCGCCGG - Exonic
1143639806 17:8189559-8189581 GCGGCGTCCGCCGCCCGCGCCGG + Exonic
1143885819 17:10064107-10064129 GCTGCAGCAGCCGCCGCTGCTGG - Intronic
1144021349 17:11241651-11241673 GCCGCCGCCACAGCCGCCGCGGG - Exonic
1144109813 17:12020921-12020943 GCCGCTGCCGCTGCCGCCCCCGG - Exonic
1144143832 17:12377563-12377585 GCTGCAGCCGCCAGTGCCGCTGG - Intergenic
1144207478 17:12989249-12989271 GCTGCTGCAGCCGCCGCCCTGGG - Intronic
1144339725 17:14301581-14301603 GCCGCCGCCGCCCCCGCCGCCGG + Exonic
1144519679 17:15945396-15945418 GCTGCGGCCGACGTGGCCGTGGG + Exonic
1144565108 17:16353345-16353367 GCAGCGGCCGCGGAGGCCGCGGG + Exonic
1144724541 17:17495260-17495282 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1144909910 17:18672509-18672531 GCTGCCACCGCCGCAGCCGGGGG - Intronic
1144910059 17:18673039-18673061 GCCGCCGCCGCCGCCGCCTGGGG + Exonic
1145265252 17:21376797-21376819 GCCGCTGCCGCCACCGCCTCAGG - Exonic
1145307522 17:21683604-21683626 GCCGCCGCCGCCGCTGCAGCAGG - Intergenic
1145307753 17:21684769-21684791 GCCGCCGCCGCCGCTGCAGCAGG - Intergenic
1145379006 17:22376854-22376876 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379484 17:22379224-22379246 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379963 17:22381594-22381616 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145380921 17:22386316-22386338 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145381401 17:22388691-22388713 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382134 17:22392465-22392487 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382609 17:22394830-22394852 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382889 17:22396193-22396215 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383462 17:22399016-22399038 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383976 17:22401484-22401506 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384414 17:22403686-22403708 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384733 17:22405148-22405170 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145750789 17:27353856-27353878 GCGGAGGCCGCCGCCCCGGCCGG - Intergenic
1145912879 17:28552586-28552608 GCTGCCGCCGCTGCCTGCGCCGG + Exonic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1145925657 17:28644956-28644978 GCCGCCGCCGCCGGCGCGGCCGG + Intronic
1146167408 17:30600733-30600755 GCTGCGACCGCCACGGCCGGAGG - Intergenic
1146183059 17:30709415-30709437 GCCGCTGCCGGCGCCGCCTCGGG + Intergenic
1146371134 17:32266153-32266175 CCCGCAGCCGCCGCCGCCCCCGG + Intergenic
1146492388 17:33292282-33292304 GCCGCCGCTGCCGCCTCCGCGGG + Exonic
1146716214 17:35089107-35089129 GCTGCGGCCGCCCTCCCGGCCGG + Exonic
1147144577 17:38477672-38477694 GCCGCAGCCCCCGCCGCCGCCGG - Exonic
1147161773 17:38572780-38572802 GCAGCCGCGGCCGCCGCCGCCGG + Intronic
1147162925 17:38578455-38578477 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
1147183653 17:38702367-38702389 GGGGCCGCCGCGGCCGCCGCCGG - Intergenic
1147200646 17:38799426-38799448 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
1147285739 17:39401575-39401597 GTTGCGGCCGCCGGCGCCGCGGG - Exonic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147486367 17:40818909-40818931 GTAGCCGCCGCCGCCGCCGCCGG + Exonic
1147486381 17:40818960-40818982 ACTGCCGCCGTGGCCGCCGCTGG + Exonic
1147486410 17:40819065-40819087 GCCGCCGCCGTGGCCGCCGCCGG + Exonic
1147677740 17:42219364-42219386 GCTGCTGCCGCCGCTTCCACTGG + Exonic
1147688296 17:42300207-42300229 GCTGCTGCCGCCGCTTCCACTGG - Exonic
1147943504 17:44066607-44066629 GCTGCTGCCGCCGCCGCCGCCGG - Exonic
1147967141 17:44199544-44199566 GCCGCCGTCGCCGCCGCCGGAGG - Intronic
1147967143 17:44199547-44199569 GCCGCCGCCGTCGCCGCCGCCGG - Intronic
1147971289 17:44220059-44220081 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1147971292 17:44220065-44220087 GCTGCTGCCGCCGCCGGGGAAGG + Intronic
1147994790 17:44354674-44354696 GCTGGCGCGGCCGCCGTCGCTGG - Exonic
1148048645 17:44758885-44758907 GCCCGGGCCGCCGCCGCGGCAGG - Intergenic
1148048746 17:44759150-44759172 GCTGCGGCTGCCAGCGGCGCGGG - Exonic
1148440411 17:47709014-47709036 GCCACCGCCGCCGCCCCCGCCGG + Exonic
1148621524 17:49038310-49038332 GCTGGGGCCCCCGCTGCCACAGG - Exonic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1148698626 17:49575654-49575676 GCCGCCGCCGCCGCCGCCGGTGG + Intergenic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1149430843 17:56594544-56594566 GCTGCGGCAGCGGCCGTCGGGGG + Exonic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1149477868 17:56978201-56978223 GCTGCTGCTGCCGCTGCTGCTGG + Exonic
1149626524 17:58083949-58083971 GCTGCCGCTGCCCCCGCCCCCGG + Intronic
1149996376 17:61408156-61408178 GCTGCCGCCGCCGCAGCCGCCGG + Exonic
1150250171 17:63700480-63700502 GCTGCGGCGGCTGCGGTCGCGGG + Intronic
1150326684 17:64263321-64263343 GCGGCGGCGGCCGCGGGCGCGGG - Intergenic
1150373509 17:64661885-64661907 GCCCCCGCCGCCCCCGCCGCCGG - Exonic
1150423170 17:65056600-65056622 GCCGCCGCCGCCGCCTCGGCGGG + Exonic
1150747296 17:67825949-67825971 GAAGCCGCCGCCGCCGCCGCCGG + Exonic
1151674125 17:75589212-75589234 GCTGCGGCGGCGGCCGCCAGAGG + Intergenic
1151755372 17:76072585-76072607 GCGGCGGACTCCGCCGCCGTCGG + Exonic
1151858001 17:76736798-76736820 GCTACGGACGCCGGAGCCGCAGG - Exonic
1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG + Intergenic
1152331945 17:79678576-79678598 CCTGCGGCTGCCGCCTCCCCGGG + Intergenic
1152353642 17:79796807-79796829 GCCACGGCCGCGGCCGCTGCTGG + Intronic
1152357291 17:79813381-79813403 GCTGCGGCGCCCGCCCCCGCCGG + Intergenic
1152433107 17:80260514-80260536 GCCCTGCCCGCCGCCGCCGCCGG - Intergenic
1152699339 17:81811340-81811362 TCTGCGGCCGCCCCGGGCGCTGG - Intronic
1152751540 17:82064787-82064809 GCTGTGGCCGCGGCCGCGGTTGG - Intronic
1152755956 17:82087149-82087171 GCTGCTCCTGCTGCCGCCGCGGG + Exonic
1152824847 17:82458438-82458460 TTGGCCGCCGCCGCCGCCGCAGG + Intronic
1153238760 18:3012841-3012863 GCCCCTACCGCCGCCGCCGCAGG - Intronic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154303995 18:13217796-13217818 GCTCCGCGCGCCGCCGCGGCCGG + Intronic
1154954607 18:21242164-21242186 GCGGCGGCCGCCGCAGCCGGAGG - Intergenic
1154954608 18:21242167-21242189 GAGGCGGCGGCCGCCGCAGCCGG - Intergenic
1155007506 18:21741524-21741546 GCCGCCGCCGCTGCCGCCGGGGG - Exonic
1155007510 18:21741527-21741549 GCCGCCGCCGCCGCTGCCGCCGG - Exonic
1155126407 18:22880832-22880854 GCTGCTGCCGCCGCCACACCTGG - Intronic
1155392184 18:25349840-25349862 GCCGCGGCCGCCTCCAGCGCTGG + Intronic
1155519924 18:26657165-26657187 GCAGGGGCCGCCGCCTCCTCCGG - Intronic
1155654334 18:28177050-28177072 GCCGCCGCCGCCGCCTCCTCCGG - Exonic
1156036154 18:32770285-32770307 GCAGCAGCCGCCGCCGCAGGAGG - Exonic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1156099623 18:33578356-33578378 GCTGCCGCCGCCCCCGCCCCCGG + Intergenic
1156213838 18:34976942-34976964 GCCGCCGCCGCCGCCGCTCCGGG - Intronic
1157279093 18:46334164-46334186 GCTGCGGGAGCCGCCGGGGCGGG - Intronic
1157609984 18:48950168-48950190 GCCGCGGGCGCCGGCGCGGCCGG - Exonic
1157849133 18:51030705-51030727 GCCGCCGCCGCCGCCGTCGTCGG - Intronic
1158404311 18:57147368-57147390 GATGGGGCCGCCGCCCCCGCTGG - Exonic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1158931037 18:62325282-62325304 GCCGCGGCAGCCGCGCCCGCTGG + Intronic
1158954142 18:62523556-62523578 GCCGCCGCCGCCGCCGCCCGCGG + Exonic
1158954159 18:62523598-62523620 GCCGCCGCCGCCGCCGCCCCGGG + Exonic
1158976505 18:62715753-62715775 GCTGCCGCAGCGGCGGCCGCCGG - Exonic
1159040288 18:63318419-63318441 GCTGCCCCCGGCGCCGCCGCGGG - Exonic
1160025359 18:75211571-75211593 GCTGCGCCCGCGGCCCGCGCCGG + Intronic
1160242394 18:77132899-77132921 GCGGCCGCCGGCGCCGCCCCGGG + Intronic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160719131 19:589895-589917 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160765671 19:806455-806477 GCAGCTGCCGCCGCCGCCGAGGG - Exonic
1160781308 19:878932-878954 GCTGCGGCCGGGGCCGGGGCCGG - Intronic
1160790457 19:920579-920601 GCCGCCCCCGCCGCCCCCGCCGG + Exonic
1160864568 19:1251092-1251114 GCGGCGGCGGCCGCCTGCGCCGG + Intronic
1160873105 19:1285890-1285912 GCCGCCGCCGCCGCACCCGCCGG - Intergenic
1160894289 19:1395487-1395509 AGCGCCGCCGCCGCCGCCGCCGG + Exonic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1160967757 19:1754044-1754066 GCGGCGGCCGCGGCCGTGGCCGG + Exonic
1161022140 19:2015537-2015559 GCCGCCGCCGCCGCCGCCCCTGG - Exonic
1161067421 19:2245565-2245587 GCTGTGGCCGGCCCCGCTGCGGG - Intronic
1161069103 19:2251631-2251653 GCGGGGGCCACCGCCGCCGACGG + Exonic
1161069655 19:2253722-2253744 GCAGCCGCCGCCGCCGCCCCCGG - Exonic
1161162912 19:2770566-2770588 GCCGCCCCCGCCCCCGCCGCTGG + Intronic
1161208370 19:3053947-3053969 GCTGCAGCCGCCTTCGCTGCCGG - Exonic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161397951 19:4054598-4054620 GCTGTGGCCGCCGTGGCCGCGGG - Exonic
1161397980 19:4054691-4054713 GCAGCGGCGGCGGCGGCCGCGGG + Exonic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1161412446 19:4123965-4123987 GCTGCGGCCGCGGCCCAGGCCGG + Exonic
1161628761 19:5340878-5340900 AGCGCCGCCGCCGCCGCCGCCGG + Intergenic
1161752901 19:6110426-6110448 GCAGCCGCTGCCGCCGCCGCGGG - Exonic
1161911554 19:7198189-7198211 GCTGCGGCCGCCGCAACCGCCGG - Intronic
1161946427 19:7440249-7440271 GCTGCGGCCGCAGTCGGAGCGGG + Exonic
1162030917 19:7916921-7916943 GCCGCCGCCGCCGCCATCGCGGG + Exonic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162311989 19:9913403-9913425 GCTGCCGCCGCCGCAGCCCCCGG - Intronic
1162374475 19:10296542-10296564 GCCGCGCCCCCCGCCGCCTCGGG - Exonic
1162416955 19:10544029-10544051 GCTGCGGCCGCTGCCCCCCAAGG - Exonic
1162572892 19:11482814-11482836 GCTGAGGCCGCCGCCTCCTGCGG - Intronic
1162778628 19:12995504-12995526 GCTGCGGCGGCGGCGGCGGCGGG + Intergenic
1162792547 19:13070498-13070520 GCTGCAGCTGCCCCGGCCGCAGG + Intronic
1162954324 19:14090033-14090055 GCCGCAGCCACAGCCGCCGCCGG - Exonic
1162954395 19:14090371-14090393 GTGGCGGCCGCCGCCGTCTCCGG + Exonic
1162975736 19:14206353-14206375 GCCGCTGCCGGCGCCGCCTCGGG - Intergenic
1163106327 19:15125028-15125050 CCCGCGGCCGCCGCCCCCGCTGG - Exonic
1163117892 19:15199719-15199741 GCAGGAGCCGCCGCCTCCGCCGG - Intronic
1163154473 19:15432491-15432513 GCCACCGCCACCGCCGCCGCGGG - Intronic
1163158906 19:15453334-15453356 GCACCGGCCGGGGCCGCCGCAGG + Exonic
1163262174 19:16197977-16197999 GCTGCCGCCGCCACCGCCCTCGG + Exonic
1163426890 19:17245185-17245207 GCCGGGGCCGCCCCAGCCGCCGG + Exonic
1163443758 19:17334645-17334667 GCCGAGGCCGCCTCCGGCGCCGG - Exonic
1163451414 19:17379465-17379487 GCAGCCGCCGACGACGCCGCTGG - Intergenic
1163480905 19:17555776-17555798 GCTGCTGGCGCCACTGCCGCCGG + Exonic
1163551170 19:17967152-17967174 GCGCCTGCCGCCGCCGCCCCCGG + Intronic
1163557627 19:18001545-18001567 GCAGCAGCTGCCGACGCCGCAGG - Intronic
1163586950 19:18169342-18169364 GCTCCCGCCGCCGCAGCCTCCGG - Exonic
1163606949 19:18280913-18280935 GCTTCGGGCGCGGCCGCCGCCGG + Exonic
1163606978 19:18280982-18281004 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163607138 19:18281572-18281594 GCTGCGGCCGCGGCCGGGGCGGG - Exonic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1164402092 19:27909689-27909711 GCTGTTGCCGCCCCCGCGGCTGG + Intergenic
1164594850 19:29526118-29526140 GCTCCCGCAGCCGCCCCCGCCGG - Intergenic
1164834534 19:31349244-31349266 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1165080113 19:33302103-33302125 GCCGCCGCCGCCGCCGCCCGTGG + Exonic
1165160471 19:33812882-33812904 GCTGCGGCCGCCGCTCCTCCCGG - Exonic
1165243054 19:34482261-34482283 GCCGCCACCGCCGCCGCCGTCGG - Exonic
1165351691 19:35279273-35279295 GCAGCCGCCGCCGCCCACGCCGG + Exonic
1165420073 19:35718098-35718120 GCCGCGGCCCCCGCCCCCGCCGG - Exonic
1165429943 19:35766862-35766884 GCTTCCGCCGCTGCCGCCACTGG - Exonic
1165493945 19:36141118-36141140 GCCGCCGCCGCCGCCGCCCCCGG - Exonic
1165601639 19:37059249-37059271 GCTGCAGCCGCGGCGGCGGCTGG - Intronic
1165961613 19:39539775-39539797 TCCCTGGCCGCCGCCGCCGCCGG + Exonic
1166055423 19:40285285-40285307 GCCGCCGCCGCTGCCGCTGCCGG - Exonic
1166358675 19:42242524-42242546 GCCGCTGCCGCCGCCTCCCCCGG + Exonic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166361254 19:42253869-42253891 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1166364649 19:42272377-42272399 GCTGGGACCGCAGCTGCCGCAGG - Intronic
1166366264 19:42280099-42280121 GGTGCAGCCGCTGCCGCCGGTGG - Intronic
1166389558 19:42401576-42401598 GCTGCTGCGGCGACCGCCGCAGG - Exonic
1166529347 19:43533457-43533479 GCTGCGGCCGTGGCCGTGGCGGG + Exonic
1166733647 19:45072034-45072056 GCTGGAGCCGCCGCCACAGCAGG - Exonic
1166869735 19:45864170-45864192 GCTGCGGCCCCCGGCGCCTGAGG + Intronic
1166873948 19:45886057-45886079 GCCGCGAGCGCCGCCGCCTCGGG + Exonic
1166883070 19:45940590-45940612 GCGTCGGCCGCCGCCGCCTCCGG - Exonic
1166888030 19:45973360-45973382 GCAGCAGCAGCCGCCGCCCCAGG - Exonic
1166894663 19:46016069-46016091 GGTGCAGCCGCCCCCGACGCGGG + Exonic
1166975122 19:46601370-46601392 GCTGCAGCTGCTGCCGCCGCCGG + Exonic
1166975123 19:46601373-46601395 GCAGCTGCTGCCGCCGCCGGAGG + Exonic
1167019097 19:46861100-46861122 GCCGCCGCCTCAGCCGCCGCTGG + Intergenic
1167237174 19:48322062-48322084 GCAGCAGCCGCCGCCGCGGAGGG - Intronic
1167499275 19:49836291-49836313 GCTGCTGCCTCCGCCGCACCAGG + Exonic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168076325 19:53982545-53982567 GGCGCCGCCGCCGCCGCCGCCGG - Exonic
1168076348 19:53982599-53982621 GCCGCCTCCGCCGCCGCCCCCGG - Exonic
1168078131 19:53991640-53991662 GCTGTGCCCGCCACCGCCACCGG - Intergenic
1168095833 19:54114501-54114523 GCTGGCGCCGCCGCCGACCCCGG + Exonic
1168247005 19:55117491-55117513 GCAGCCGCCGCCGCCGCCCCCGG + Exonic
1168293433 19:55368215-55368237 GCTGCAGCCGGCGCAGCAGCCGG + Exonic
1168401632 19:56088698-56088720 GCTGCGGCCGCAGTCGGGGCAGG + Exonic
1168641514 19:58034416-58034438 GCTGGGGCCGCCCCTTCCGCAGG + Intronic
1168719029 19:58544788-58544810 GCAGCGGCCTCGGCCGCCTCTGG + Exonic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
925013427 2:503468-503490 GCTGGCGCCGCCTCCCCCGCTGG - Intergenic
925609911 2:5693752-5693774 GCTGCTGCTGCCGCTGCTGCTGG - Exonic
926189952 2:10721279-10721301 GCTGCGGCGGCCGCAGCGGGAGG + Intergenic
926217103 2:10912359-10912381 GCCGCCGCCGCCGCTGCCGCTGG - Exonic
926305411 2:11634363-11634385 GCTGCCGCCGCCTCTGCCCCAGG - Intronic
927472271 2:23385400-23385422 CCCGCGGCCGCCGCGGCTGCGGG + Exonic
927652297 2:24920050-24920072 CTAGCAGCCGCCGCCGCCGCGGG - Intergenic
927920765 2:26970673-26970695 GCTGAGGCCGCCGCGGTCTCCGG - Exonic
928511766 2:32010084-32010106 TCCCCGCCCGCCGCCGCCGCGGG + Intronic
928549502 2:32357252-32357274 GCTGCGGCTGCGGCGGCCTCGGG + Exonic
928606357 2:32947621-32947643 ACCGCCGCCGCCGCCGCCGCCGG + Exonic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
929701946 2:44169472-44169494 TCCCCGGCCGCCGCCTCCGCTGG + Intronic
930136109 2:47905618-47905640 GCTGCGGCGGCGGCTGCTGCGGG + Exonic
930358223 2:50346884-50346906 GCCGCCGCCGCCGCCGCCCCCGG + Intronic
930762377 2:55050324-55050346 GCAGCTGCTGCCGCCGCCGCCGG + Exonic
930782125 2:55233156-55233178 CCTGCGGCCGCCGCCCGCTCTGG + Intronic
930847764 2:55923796-55923818 CCTGCCGCCGCGGCCGCTGCCGG - Exonic
931253507 2:60552418-60552440 GCCGCCGCCGCCGCCGCCGAAGG - Intronic
931254109 2:60555284-60555306 GCAGCCGCCGCCGCCGCCGCCGG + Intergenic
931255572 2:60569217-60569239 GCTGCTGCCGCCGCTGCCCACGG - Intergenic
931671739 2:64653941-64653963 GCTCCGGGCCCCGGCGCCGCAGG + Intronic
932567358 2:72918153-72918175 GCCGCGGCCGCCGCGGGCGCGGG + Exonic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932621865 2:73269443-73269465 GCCGCCGCCGCCGCTGCCTCGGG - Exonic
932699848 2:73985057-73985079 GCCGCCGCCGCCGCCGCCTGGGG - Intergenic
932773959 2:74516060-74516082 GCTGCGGCCGCCGCTGCCCCCGG + Exonic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
934079113 2:88452453-88452475 GCCGCCACCGCCGCCGCCCCGGG - Exonic
934776385 2:96940290-96940312 GCTGCTGCTGCCACCGCCACAGG + Intronic
934966854 2:98731106-98731128 GCCGCTGCCGCCGCCGCTGCGGG + Intronic
935196642 2:100820238-100820260 GCCGCCGCCGCCGCGGCTGCGGG - Exonic
935349707 2:102142751-102142773 GCTGCGCCCGCCCTCGCGGCCGG - Intronic
935592438 2:104855285-104855307 GCCGCCGCCGCCGCGGCCCCCGG - Intergenic
935592639 2:104855924-104855946 GCCGCCGCCGCCACCGCCGCAGG + Exonic
935592736 2:104856229-104856251 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
935634881 2:105242593-105242615 GCTGCCGCTGCAGGCGCCGCAGG - Exonic
935692616 2:105744882-105744904 GCCGCCGCCGCCGCTGCCGCGGG + Exonic
936122699 2:109760437-109760459 GCCGCCGCCGCCGCCGCCCCCGG - Intergenic
936221994 2:110611036-110611058 GCCGCCGCCGCCACCGCCCCCGG + Intergenic
936279152 2:111122661-111122683 GCTGCCCCGGCCGCAGCCGCCGG - Intronic
937044990 2:118846554-118846576 GCCGCCGCCGCCGCCGCAGCCGG + Exonic
937045117 2:118847042-118847064 GCCGCTGCCGCTGCTGCCGCTGG + Exonic
937160818 2:119759722-119759744 GTTGCTGCCGCCGCCGCTCCTGG + Exonic
937221600 2:120345656-120345678 GCTGCGGCGGGCGCTGCGGCGGG - Intergenic
937933067 2:127220216-127220238 GCTGCGGCCGGCGCCCGAGCGGG - Intergenic
937956232 2:127423127-127423149 GCTGCGACTGCCGCAGCGGCTGG + Exonic
938273022 2:129992528-129992550 GCTGCCGCCGCCGCCGGCGCTGG - Intergenic
938380599 2:130834373-130834395 GCTGCTGCCGCTGCCGTAGCCGG + Intergenic
938443202 2:131353578-131353600 GCTGCCGCCGCCGCCGGCGCTGG + Intronic
938518390 2:132038682-132038704 TTCGCGCCCGCCGCCGCCGCTGG - Intergenic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
939900614 2:147845242-147845264 GCAGCGGCCGCCGCGGCCGCAGG - Intronic
940640762 2:156342384-156342406 GCAGCTGCCGCAGCCGCCGGGGG - Intergenic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941819126 2:169827514-169827536 GCGGCGGCCGCGGCGGCCGTCGG + Exonic
941951382 2:171160459-171160481 GTTGCCGCCGCTGCCGTCGCAGG - Exonic
941951523 2:171160961-171160983 GCCGCCGCCGCCGCCGCTACCGG - Intronic
941951529 2:171160982-171161004 GCGGCGGCAGCGGCGGCCGCGGG + Intronic
942046703 2:172103054-172103076 GCTGCGGCTGCAGCGGCCCCAGG + Intergenic
942240824 2:173963765-173963787 GCCGGGGCCCCCGCCGCCGCCGG - Exonic
942241114 2:173964681-173964703 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942278093 2:174336941-174336963 GCCGCGGCTGCCGCCGCCGGGGG + Exonic
942278205 2:174337481-174337503 GCGGCGGCGGCGGCCTCCGCGGG + Exonic
942446081 2:176079994-176080016 GCTGCTGCCGCTGCCGCCAGGGG - Exonic
942454826 2:176130415-176130437 GCTGCGGCGGCGGCGGCGGCGGG + Exonic
943060532 2:183038106-183038128 GCTGGTGCCGCCGCCGCCGCCGG + Exonic
943571507 2:189580772-189580794 GCCGCCGCCGCCGCCGCCGTGGG + Exonic
943624150 2:190180543-190180565 GCAGCTGCCGGCGCCGCAGCGGG - Intronic
943645904 2:190408106-190408128 GACGCATCCGCCGCCGCCGCAGG + Intergenic
944273087 2:197804958-197804980 GCCGCCGCCACTGCCGCCGCTGG + Exonic
944412443 2:199457722-199457744 GCCGCCGCCGCCGCCGCCTCCGG - Exonic
944547570 2:200812464-200812486 GTTGCGGCGGCCGCCACCGCAGG + Exonic
944743729 2:202635607-202635629 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
945225826 2:207530329-207530351 GCTGCCGCCCCGGCCGCCGCTGG - Intronic
945699417 2:213151723-213151745 GCTGCGGCGGCGGCGGCGGCGGG + Intronic
946248567 2:218400232-218400254 GGAGCCGCCGCCGCCGCCCCGGG + Intronic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
947119293 2:226799382-226799404 GCTGCTGCTGCCGCCGCCCGCGG + Exonic
947188017 2:227472281-227472303 GCTGCGGCCGGGTCCGGCGCGGG + Exonic
947506659 2:230713051-230713073 CGCGCAGCCGCCGCCGCCGCGGG + Exonic
947741664 2:232487583-232487605 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
948801594 2:240435777-240435799 TCCTCGGCCGCCGCCGCCTCTGG + Exonic
948828539 2:240586289-240586311 GCTGCGGAGGCCGTGGCCGCGGG - Intergenic
948954003 2:241272915-241272937 GCTGGGGTCCCCGCCGCCCCGGG + Intronic
1168753126 20:297754-297776 GCCGCGGCCGCCGCGGCGGGAGG + Exonic
1169065564 20:2692799-2692821 GCCGCCGCCGCCGCCGCTCCCGG - Intergenic
1169093165 20:2873619-2873641 GAGGCCGCCGCCGCCGCCGCGGG + Intronic
1169214728 20:3786511-3786533 GGCGCCGCCGCCGCCGCCCCGGG + Exonic
1169488383 20:6052307-6052329 GCTGCGGGCGCTGCAGCCCCGGG - Exonic
1169557620 20:6767689-6767711 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1170756918 20:19212880-19212902 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1170889971 20:20368423-20368445 GCTGCCGCCGCCGCCGCCCGCGG + Exonic
1171532491 20:25861773-25861795 GCTGCAGCCGCGGCGGCGGCTGG + Intronic
1171532823 20:25863430-25863452 GCTGCAGCCGCGGCGGCGGCTGG + Intronic
1171544028 20:25987195-25987217 GCTGCAGCCTCCGCGGCAGCTGG - Intergenic
1171847140 20:30284071-30284093 GCTGCCGCCGCGGCGGCGGCTGG - Intergenic
1172015530 20:31870543-31870565 GCTGCCACCGCCGCCGCCGCAGG + Exonic
1172037310 20:32019123-32019145 GCTGCCGCCGCCGCCTCCCCCGG - Exonic
1172083174 20:32358520-32358542 GCAGCCGCCGCTGCCGCCGTGGG + Exonic
1172143965 20:32743453-32743475 GCTGCCGCTGCCACCGCTGCCGG + Exonic
1172284601 20:33731993-33732015 GCCGCCGCCGTCGCCGCCACAGG - Exonic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1172640192 20:36436113-36436135 GCTCCACTCGCCGCCGCCGCCGG - Exonic
1172919960 20:38473021-38473043 GCCGGGGCGGGCGCCGCCGCCGG - Exonic
1173243434 20:41317604-41317626 GCCGCCGCCGCCGCCTCTGCGGG - Intronic
1173516191 20:43667100-43667122 ACTGCAGTCGCCGCCGGCGCGGG - Intronic
1173855996 20:46251195-46251217 GCCGCCGCCGCCGACGCTGCTGG - Exonic
1173982934 20:47238976-47238998 GCCCCGGCCCCCGCCGCCACAGG - Exonic
1174017672 20:47501948-47501970 GCTCAGCCCGCAGCCGCCGCCGG - Exonic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1174357822 20:50010100-50010122 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1174386499 20:50190913-50190935 GCTGCTGCTGCCGCCGCTGCCGG - Exonic
1174467919 20:50731643-50731665 GCTGCGGCCGCCCCCTCTGCAGG + Exonic
1174494638 20:50931000-50931022 GCTGCGCCCGCCGCGCCCCCCGG - Exonic
1174494667 20:50931112-50931134 GCGGCCGCCGCCGCCCGCGCCGG - Exonic
1174494731 20:50931312-50931334 GTTGCCGCCGCCGCCTCCGCCGG - Intergenic
1174494850 20:50931770-50931792 GCTGCTTCTGCCTCCGCCGCCGG - Intergenic
1174607044 20:51768469-51768491 GCTGCCGCCGCCTCCTCCCCCGG - Exonic
1175429523 20:58891673-58891695 GCTGCGGCGGCGGCGGGCGCGGG - Intronic
1175429538 20:58891709-58891731 GCCGCCGCCGCCGCCGCCATGGG + Intronic
1175847235 20:62065365-62065387 GCCGCCGCCGCCGTCGCCGCGGG - Exonic
1176071601 20:63229532-63229554 GCAGCGGCAGCCGCTGCCGGGGG - Intergenic
1176201307 20:63861906-63861928 GCTGCTGCCGCTGCTGCAGCAGG + Exonic
1176207097 20:63895153-63895175 GCCGCTGCCGCTGCCGCTGCCGG + Intergenic
1176207110 20:63895198-63895220 GCCGCCGCCGCCGCCGCCCGGGG + Exonic
1176236080 20:64054164-64054186 GCTGCGGCCCCGGCCCCCACTGG + Intronic
1176952589 21:15064691-15064713 GTAGCGGCCGCCGGCGCCGCCGG - Intronic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178334668 21:31732277-31732299 GCGGCCGCCGCCGCCGCCGGCGG - Intergenic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178334672 21:31732286-31732308 GCGGCGGCGGCCGCGGCCGCGGG + Intergenic
1178453709 21:32727978-32728000 GCAGCCGCCGCCACAGCCGCCGG + Exonic
1178839871 21:36130053-36130075 TCCGCGCCCGCCCCCGCCGCGGG - Intergenic
1178914628 21:36699527-36699549 GCAGCGGCGGGCGGCGCCGCCGG + Exonic
1178961912 21:37073289-37073311 GCCGCCGCCGCCGCCACCTCCGG - Intronic
1178992447 21:37367028-37367050 GTTGGTGCCGCTGCCGCCGCCGG + Intronic
1179561592 21:42219237-42219259 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1179645401 21:42772186-42772208 GCTGCAGCCACCACAGCCGCGGG - Intronic
1180018173 21:45101078-45101100 GCCGCGGCGGCGGCCGCTGCCGG + Intronic
1180172513 21:46067131-46067153 GCTGGGGCCACGGCCGCAGCTGG + Intergenic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1180559232 22:16601992-16602014 GCGGCGGCGGCCGCGGCGGCGGG + Intergenic
1180649957 22:17369506-17369528 GCGGCCGCCGCCGCAGCCGCGGG + Exonic
1180908335 22:19431477-19431499 TGTTCGGCCGCCGCCGCCGCCGG + Exonic
1180950667 22:19719144-19719166 GCTGCCGCCGCCCCCGCGGCTGG + Intronic
1180962110 22:19766760-19766782 GCGGCGGCGGCCGCGGCGGCTGG - Exonic
1181026840 22:20131785-20131807 GCAGCAGCCGCCGCCGCCCGTGG + Intronic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181299143 22:21867260-21867282 GCTGCGTCCGCTGCGGCCCCGGG + Intronic
1181572029 22:23772939-23772961 GCTCCAGCCGCCGCCGCTGCTGG + Exonic
1181725133 22:24806230-24806252 GCTGCTGCTGCAGCCGCGGCGGG - Intronic
1182257765 22:29050544-29050566 GCTGCCCCCTCCGCCCCCGCGGG - Exonic
1182494225 22:30694944-30694966 GCTGTGGCGGCCGCTCCCGCGGG + Exonic
1182532303 22:30969627-30969649 GCTGCCGCCGCCGCCTCCCCCGG - Intergenic
1182532306 22:30969636-30969658 GCGGCGGCGGCAGCGGCCGCGGG + Intergenic
1182567684 22:31212309-31212331 GCTCCTGCCGCCGCCGCCTCAGG - Intronic
1182771862 22:32801978-32802000 GCCGCTGCTGCCGCCGCTGCCGG - Exonic
1182903974 22:33920814-33920836 GCGGCCGCTGCAGCCGCCGCGGG + Intronic
1183540519 22:38426934-38426956 GCGGCGGCCGCGGTGGCCGCAGG - Exonic
1183574910 22:38681982-38682004 GCTGCCGCCGTCGCTGCTGCCGG + Exonic
1183744747 22:39685961-39685983 GATGCGCCCGCAGCCCCCGCAGG - Exonic
1183780235 22:39994839-39994861 GGAGGGGCCGCCGCCTCCGCCGG - Intergenic
1183912862 22:41092136-41092158 GCTACGGCCCCCACCGCCGGCGG - Exonic
1183951970 22:41357400-41357422 GCTGCTGCCACCGCCACCACTGG + Exonic
1184035120 22:41914562-41914584 GCTGCTGGCGCGGCCGCCGTCGG - Exonic
1184489997 22:44803000-44803022 GCTGCTGCTGCCGCCACCACTGG + Intronic
1184523463 22:45008702-45008724 GCTGCGGCCGGCCCCGCCCGTGG - Intronic
1184759690 22:46537443-46537465 GGAGCCGCCGCCGCCGCCGCAGG - Intergenic
1185037935 22:48489464-48489486 GCCGCCGCCGCCGCCGCGCCCGG - Exonic
1185055264 22:48575864-48575886 GCCGCCACCGCCGCCGCGGCGGG - Intronic
1185130822 22:49037619-49037641 GCTGCGGCCTCTCCCGCTGCAGG - Intergenic
1185173222 22:49305355-49305377 GCTGCTGCCGCCTCTGCCGCCGG + Intergenic
1185248677 22:49787638-49787660 ACCGCGGAGGCCGCCGCCGCCGG + Intronic
1185259550 22:49853935-49853957 GCTGCGGACGACGGCGGCGCGGG - Exonic
1185268769 22:49918814-49918836 GCTGCTGCTGCCGCCCGCGCCGG + Exonic
1185268770 22:49918817-49918839 GCTGCTGCCGCCCGCGCCGGAGG + Exonic
1185313766 22:50170317-50170339 GATCCCGCCGCCGCCCCCGCCGG + Intergenic
1185336176 22:50271780-50271802 ACCGCGGCCGCGGCCGCCGGGGG + Intergenic
1185371197 22:50461688-50461710 GCTGCGGCCGCGCCTGCTGCCGG - Exonic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
949414383 3:3799850-3799872 GCTGCCGCCGCCGCCGCCGTGGG + Exonic
949970239 3:9397670-9397692 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
949970243 3:9397673-9397695 GCCGCCGCCGCCGCTGCCGGGGG + Intronic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
950153815 3:10707951-10707973 GCTGCCGCCGCCGCTGCCGCTGG + Intronic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
951208324 3:19947266-19947288 TCCGCCGCCGCCGCCGCCGCCGG - Exonic
951217777 3:20040637-20040659 GCTGCAGCCACTGCCGTCGCCGG - Exonic
951485286 3:23203233-23203255 GCCGCCGCTGCCGCCGCCCCCGG - Intronic
951640313 3:24829164-24829186 GGCGCGGCCGCCGCCGCCTCCGG + Intergenic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952287293 3:31981207-31981229 GCCGGGGCCGCCACCGCGGCGGG - Exonic
952347574 3:32502755-32502777 GCTGCGGCCGCCGCGCTCCCCGG - Exonic
952744450 3:36764221-36764243 CCCGCAGCCGCCGCCGCCCCCGG - Intergenic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
953027531 3:39153564-39153586 CCCGCCGCCGCCGCCGCTGCCGG - Exonic
953672697 3:44976127-44976149 GCCGCGGCCGCCGCCACTGCCGG - Exonic
953705207 3:45225816-45225838 GCCGCCGCCGCCGCCTCCTCCGG + Exonic
953750214 3:45602914-45602936 ACTGCGGCCACCGCCTCCCCGGG + Intronic
953909283 3:46883508-46883530 GCAGCCGCCGCCGCCGGCCCTGG - Exonic
953947771 3:47164007-47164029 GCCGCCGCCGCCGCCGCGGTCGG - Intergenic
954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG + Exonic
954540880 3:51392267-51392289 GCCGCTGCTGCCGCCGCCGTGGG + Exonic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
954838952 3:53494708-53494730 GCCGCCGCCCGCGCCGCCGCTGG - Intronic
955387610 3:58492063-58492085 GCCGCCGCCGCCGCCGTCGCCGG + Intergenic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
955911598 3:63864011-63864033 GCGCCGGCCGCGGCCGCCCCCGG - Intergenic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956417861 3:69052100-69052122 GGTGCTGCCGCCGCCACTGCCGG - Exonic
956468648 3:69542639-69542661 GCAGCGGCCGCCCCAGCCCCCGG - Intergenic
956658970 3:71581589-71581611 GCTGCCGGCGCCTCCTCCGCGGG - Intronic
956659485 3:71583797-71583819 GCCGCCGCCGCCACCGGCGCTGG - Intronic
956659488 3:71583803-71583825 GCCGCCGCCGCCGCCGCCACCGG - Intronic
956978948 3:74614515-74614537 GCGTAAGCCGCCGCCGCCGCAGG + Intergenic
957350637 3:79018947-79018969 GCTGCTATCGCCGCCGCCGCGGG - Intronic
959591896 3:108090924-108090946 GGGGTCGCCGCCGCCGCCGCAGG + Exonic
961012938 3:123448195-123448217 ACTGCGGTCGCGGCAGCCGCCGG - Exonic
961081618 3:124033202-124033224 GCTGCGGCGGCGGCGGCGGCGGG + Intergenic
961202480 3:125055812-125055834 GCTGCTGCTGCTGCCGCCGGCGG - Exonic
961236961 3:125375343-125375365 GCCGCGGTCGCCGCCACTGCCGG + Exonic
961446267 3:126983155-126983177 GCCGAGGCCGCCGCCGCGCCCGG - Intergenic
962722314 3:138187514-138187536 GCTGCTGCAGGCGCCGGCGCGGG - Exonic
962793990 3:138835005-138835027 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
963038510 3:141051893-141051915 GCTGCCGCCGCCGCCCACTCAGG - Exonic
963236737 3:142963695-142963717 GCCTCCGCCGCCGCCGCCCCCGG + Intergenic
963240911 3:143001593-143001615 GCTGCTGCCGCCGCCGAAGGAGG + Exonic
963253093 3:143120069-143120091 GCAGCCGCCGCCGCCGCTGCGGG + Exonic
963259263 3:143176744-143176766 GCTGCAGCCGCTGCAGCCTCTGG + Intergenic
963602553 3:147390832-147390854 GCTGCTGCCGCCGCCGCCTCCGG - Intronic
963904452 3:150762655-150762677 GCCGGCCCCGCCGCCGCCGCCGG + Exonic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
964720622 3:159764765-159764787 GCCCCCGCCGCCGCCGCTGCGGG - Exonic
965648415 3:170908606-170908628 GCGGCCGCCACCGCCGCTGCCGG - Exonic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
966362780 3:179148394-179148416 GCTGCTGCTGCCGCGGCCGCTGG + Intronic
966362792 3:179148424-179148446 GCTGGGGCCGCCGGCGAGGCAGG + Intronic
966849404 3:184155446-184155468 GCGGCGGCCGCGGCGGCGGCGGG + Exonic
966911420 3:184562256-184562278 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
967858259 3:194134283-194134305 GGAGTCGCCGCCGCCGCCGCCGG - Intergenic
967916715 3:194583886-194583908 GCAGCCGCCGCCGCAGCCGAAGG - Intergenic
968092796 3:195909057-195909079 GCTGCTGCAGCAGCCTCCGCGGG + Intronic
968225216 3:196968834-196968856 GGGGCCGCCGCCGCCGGCGCAGG + Intronic
968433817 4:575186-575208 GCTGCAGCCGCCGCCCCCGCCGG + Intergenic
968472172 4:787172-787194 GATGCGGCCGCGGCCCCAGCAGG + Intronic
968515129 4:1012512-1012534 CCTGCTGCCGCCGCTGCTGCTGG + Exonic
968562223 4:1290068-1290090 GCTCCCGCCGCCCTCGCCGCTGG - Intronic
968674716 4:1871348-1871370 CCCGCCGCCGCCGCCGCAGCCGG - Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
968729266 4:2262003-2262025 GCAGCGGCCGCCGCCGTCCCGGG - Exonic
968775381 4:2536820-2536842 GCTGAGGCGGCCGCGGCGGCGGG - Intronic
968835882 4:2963878-2963900 GCCGCCGCCGCCGCCTCCGCAGG - Exonic
968835922 4:2964046-2964068 CCTGGCGCCGCCGCCGCCGGCGG - Exonic
968850569 4:3074975-3074997 GCTTCCTCAGCCGCCGCCGCAGG + Exonic
968914857 4:3492949-3492971 GCTGCGTCCGCGGCAGCTGCAGG + Exonic
969330821 4:6472630-6472652 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
969715876 4:8867850-8867872 CCCCCGGCCGCAGCCGCCGCTGG - Exonic
970194633 4:13542431-13542453 CCCGCTGCCGCCCCCGCCGCCGG + Exonic
970195212 4:13544910-13544932 GCTACCGCCGCCGCCGCCGGGGG - Exonic
970195215 4:13544913-13544935 GCGGCTACCGCCGCCGCCGCCGG - Exonic
970202885 4:13627497-13627519 GCAGCCACCGCCGCCGCCGCCGG - Exonic
970202890 4:13627515-13627537 GCTGCGGCTGCGGCTGCGGCGGG + Exonic
970332791 4:15002876-15002898 GCTGCCCGCGCCGCCGCCGAGGG - Exonic
971195705 4:24470765-24470787 GCTGCTGCTGCCGCGGCGGCGGG + Intergenic
971757562 4:30721979-30722001 GCCGCCGCTGCCGCCGCCTCCGG - Exonic
972312072 4:37891129-37891151 CCTGTTGCTGCCGCCGCCGCGGG + Exonic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972396847 4:38664749-38664771 GCAGCGCCCGCCGCCGTCCCGGG + Intronic
972686915 4:41360777-41360799 GCCGCCGCCGTCGCCGCCGCAGG - Exonic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
972765788 4:42151695-42151717 GCGGCGGCCGCCGGCACCGGCGG - Exonic
972765789 4:42151698-42151720 GCGGCGGCGGCCGCCGGCACCGG - Exonic
972765791 4:42151704-42151726 CCGGCGGCCGCCGCCGCGCCTGG + Exonic
972960648 4:44448420-44448442 GCGTCGGCCGCCGCCGCCCCGGG - Exonic
974385652 4:61200512-61200534 GCCGCCGCCGCCGCTGCTGCTGG + Intergenic
975342592 4:73258628-73258650 GCAGCCGTCGCCGCCGCCACCGG + Exonic
975444381 4:74445357-74445379 GCTGCTACCGCCGGCGCCGGTGG + Exonic
975689527 4:76950032-76950054 ACAGCCGTCGCCGCCGCCGCGGG - Intronic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
975779093 4:77820043-77820065 GCTGGGGCTGCCGCCGCTGCGGG + Intergenic
976184255 4:82429585-82429607 GCGGCGGCCGCGGCCGCCAATGG + Exonic
976199092 4:82561795-82561817 GCTGCAGCCCCCGCCGTCCCCGG + Intronic
976199148 4:82561950-82561972 GCCGCCGCCGCCACCGCAGCAGG - Intronic
976246815 4:83012842-83012864 GCCGCCGCCGCCGCTGCTGCTGG - Intronic
976389364 4:84493328-84493350 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
976390003 4:84497666-84497688 GCCGCGGCCGTGGCCGCCGTGGG - Exonic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
976830340 4:89307868-89307890 GACGCCGCCGCCGCCCCCGCCGG + Exonic
976897370 4:90128111-90128133 GGAGCGGCCGCCGCGGCCGCAGG - Intronic
977257545 4:94757911-94757933 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
978072534 4:104491317-104491339 GCCGCCGCCGCCGCCACCGCCGG + Exonic
978072536 4:104491320-104491342 GCCGCCGCCGCCACCGCCGGCGG + Exonic
978503502 4:109433676-109433698 TCGGCGGCCGCCGCGGGCGCGGG - Intergenic
978515042 4:109560415-109560437 GCCGCTGCCGCCTCCGCCCCAGG + Exonic
978617932 4:110614368-110614390 GATGCCCCCGCCGCCGTCGCCGG - Intergenic
978619330 4:110622919-110622941 GCAGCGGCTGCTGCCGCCGCAGG - Exonic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
979785605 4:124712570-124712592 ACTGCAGCCGCCTCCTCCGCCGG + Exonic
980053800 4:128061556-128061578 GCAGCGGCGGCCACGGCCGCCGG + Intronic
980130065 4:128809970-128809992 GCCGCCGCCGTCGCCGCCGCGGG - Intronic
980920914 4:139084467-139084489 GCTGTGGCGGCCGCCGCAGCTGG + Intronic
980929992 4:139176464-139176486 TCTGCGGCCGGCGCCGGGGCTGG - Intronic
980969408 4:139555614-139555636 GACGGGGCCGCGGCCGCCGCGGG + Intronic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981550601 4:145937743-145937765 GCCGCCGCCGCCGCTGCCGCCGG + Intronic
981550603 4:145937746-145937768 GCCGCCGCCGCTGCCGCCGGCGG + Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983238711 4:165207711-165207733 GCGGGGGCCGCCGCCGCAGGTGG + Intronic
983538020 4:168878329-168878351 GCTGCCCTCGCAGCCGCCGCCGG + Intronic
983923433 4:173371258-173371280 GCGGCCGCCGCCGCCTCGGCGGG + Exonic
983940284 4:173529557-173529579 GCCGCCGCCGCCGCCGCCTCCGG + Exonic
984063350 4:175019562-175019584 GCTGCTGCTGCCGCTGCTGCAGG - Intergenic
984462994 4:180059163-180059185 GGAGCCGCCGCCGCCGCGGCCGG - Intergenic
984778665 4:183505123-183505145 GCACCGGCCGCGGCCGCCGCGGG - Exonic
984917011 4:184734035-184734057 GCGGCCGCCGCCGCCCCCGCGGG + Exonic
985633921 5:1026847-1026869 GCTGCAGCCACCGCCACCTCAGG - Intronic
985896184 5:2751181-2751203 GACGCCGCCGCCGCCGCCGCCGG - Exonic
986297082 5:6448723-6448745 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
986297120 5:6448810-6448832 CCCGCCGCCGCCGCCACCGCCGG - Exonic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986330585 5:6713851-6713873 GCCGCCGCCGCCGCCGCCACCGG + Intergenic
986506648 5:8458155-8458177 GCTGAGGCCCCAGCCCCCGCAGG - Intergenic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
987088001 5:14487569-14487591 ACTGTGGCCGCTGCCGCCACTGG - Exonic
987258264 5:16179467-16179489 GCCGCCGCCGACGCCGCCGCCGG - Exonic
988437528 5:31193800-31193822 GCCGCCGCCGCCGCGGTCGCCGG - Exonic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
989710383 5:44389663-44389685 GTTGCGGCCGCAGCCTCCGCCGG + Intronic
989812670 5:45696208-45696230 GCCGCCGCCGCCGCCGCGACGGG - Intergenic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
991435907 5:66596841-66596863 GCCGCCGCCGCCGCCGCCGTTGG + Exonic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
991676561 5:69094293-69094315 CCCAAGGCCGCCGCCGCCGCCGG - Exonic
992105725 5:73448042-73448064 GCCGCCGCCGCCGCCCCCACCGG + Exonic
992269934 5:75053554-75053576 GCTGCGGAGGCCGCCCCGGCGGG + Intergenic
992515983 5:77492458-77492480 GCCGCAGCCGCCCCCGCCGTCGG - Exonic
992528079 5:77630563-77630585 GCTGCCTCTGCCGCCGGCGCTGG - Exonic
992716247 5:79514036-79514058 GCCGCTGCCTCCGCCTCCGCCGG + Exonic
992940074 5:81751950-81751972 GCAGGGGCCGCTGCGGCCGCAGG - Intergenic
993502376 5:88678411-88678433 GTCGCTGCCGCTGCCGCCGCGGG + Intergenic
993900507 5:93581272-93581294 GCCGCCGCTGCCGCCGCCGGGGG - Intergenic
993901218 5:93585112-93585134 GGCGCCGCCGCCGCCGCCGCGGG - Exonic
994043468 5:95284148-95284170 GCTGCTCCCGAGGCCGCCGCGGG + Exonic
995106245 5:108381032-108381054 GCAGCCCCCGCCGCCGCAGCGGG + Exonic
995106360 5:108381430-108381452 GCCGCTCTCGCCGCCGCCGCGGG - Exonic
995571697 5:113488355-113488377 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
995735536 5:115296491-115296513 GCTGCGGCCACCGCGGTAGCCGG - Exonic
996404174 5:123090170-123090192 GCCGCCGCCGCCCCCGCCCCCGG + Exonic
996442951 5:123512481-123512503 GCCGCCGCCGCTGCCCCCGCCGG + Intronic
996862880 5:128084514-128084536 CCCACTGCCGCCGCCGCCGCCGG - Exonic
996978452 5:129461334-129461356 GCTCCGGCCCCCGCCGCCGTCGG + Exonic
997013381 5:129904559-129904581 GCTGCCGCCACCGCCGCCGCCGG + Exonic
997319160 5:132963582-132963604 GCTGCCGTCGCCGCCGCCAGCGG - Exonic
997975415 5:138439078-138439100 GCCGCTGCAGCAGCCGCCGCGGG - Exonic
998199415 5:140107826-140107848 GCCGCCGCCGCCGCCGCAGACGG - Intronic
998406653 5:141878192-141878214 GCTGCTGCCTCCACCGCCGCCGG + Intronic
999726984 5:154445896-154445918 GGCGGGGCTGCCGCCGCCGCTGG - Intergenic
999731190 5:154477791-154477813 GCTGCAGCCGCCACCGCCTATGG - Exonic
999868628 5:155728278-155728300 GCTGCCGCTGCTGCCGCTGCCGG + Intergenic
1000209892 5:159099251-159099273 GCAGCGGCAGCTGCTGCCGCGGG - Intronic
1000319026 5:160119160-160119182 GCCGCCACCGCCGCCGCCGGGGG - Exonic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1001688717 5:173616320-173616342 GATGGGGCCACCGCCCCCGCTGG + Exonic
1002591075 5:180291982-180292004 GCCGCCGCCGCCGCCGCAGTGGG + Exonic
1002591099 5:180292058-180292080 GCTGCCGCCGCCGCGGCGCCCGG + Exonic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1002887867 6:1312160-1312182 GCTGCGGGCGCAGCGGCCTCGGG + Intergenic
1002898159 6:1390846-1390868 GTCGCCGCCGCCGCCGCCCCCGG - Exonic
1002927002 6:1610527-1610549 GCGGCGGCCGCGGCGGCCGGGGG + Exonic
1002927346 6:1611910-1611932 GCGGCGGCGGCGGCGGCCGCAGG + Exonic
1002927920 6:1615321-1615343 ACTGCGGCCGCCACCTCCTCCGG - Intergenic
1002991873 6:2245756-2245778 CCTGCCGCCGCCACCGCCTCAGG + Intergenic
1003049290 6:2765583-2765605 GCTGCGGCCGCGCCGGGCGCCGG + Exonic
1003049416 6:2766049-2766071 CCGGCGGCCGCCGCCGCGGCGGG + Exonic
1003603808 6:7542007-7542029 GCTGGTGCCCCCGCCGCCGCTGG - Exonic
1003624089 6:7727049-7727071 GCGGCGGCGGCCGCGGCAGCGGG - Exonic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1003624094 6:7727055-7727077 GCCGCGGCCGCCGCCGCCGGGGG + Exonic
1004174560 6:13328512-13328534 GCTGCCGCTGCCGCCGCCGCCGG + Intronic
1004216840 6:13711430-13711452 GCTGTCGCCGCCACCGCCGGCGG - Exonic
1004216841 6:13711433-13711455 GCAGCTGTCGCCGCCACCGCCGG - Exonic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1004924053 6:20402374-20402396 GCCGCCGCTGCCGCCGCCCCGGG + Exonic
1004924528 6:20403851-20403873 TCGGGGGCCGCCGACGCCGCGGG + Intronic
1005743452 6:28814286-28814308 GCCTTTGCCGCCGCCGCCGCAGG - Intergenic
1006093931 6:31644306-31644328 GCTGTTGCCTCCGCGGCCGCAGG - Intronic
1006187217 6:32188360-32188382 GCTGCAGCCGCTGCAGCCTCTGG - Exonic
1006302353 6:33200322-33200344 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006614673 6:35318297-35318319 GCTGCGGCTGCAGCAGCTGCAGG + Exonic
1006617945 6:35342572-35342594 GCTGCGGCCGCCGCGGACCTGGG + Intronic
1006725401 6:36196503-36196525 GGCGCCGCCGCCGCCGCCACGGG - Intergenic
1006725409 6:36196546-36196568 GCCCCGGCCGCCGCCGCGCCAGG + Intergenic
1007409387 6:41653217-41653239 CCTGCTGCTGCCGCTGCCGCAGG + Intronic
1007410052 6:41656400-41656422 CCTGCAGCCGCCGCCACCCCTGG + Intergenic
1007473355 6:42104657-42104679 GCTGCGGCCGGTGCCACCGTGGG + Exonic
1007625341 6:43243506-43243528 GCTGCCGCCGCCGTCGCCCAAGG + Intergenic
1007625405 6:43243676-43243698 GCCGCAGCCGCAGCCGCAGCGGG + Exonic
1007784201 6:44270777-44270799 ACCGCCGCCGCCGCCGCCGGCGG - Exonic
1007784203 6:44270780-44270802 GCCACCGCCGCCGCCGCCGCCGG - Exonic
1009808827 6:68635551-68635573 ATAGCAGCCGCCGCCGCCGCCGG + Exonic
1009905641 6:69867385-69867407 GCAGCCACCGCCGCCGCCGCCGG + Intronic
1010141881 6:72622137-72622159 GCTGCCCCCGCCGCAGGCGCTGG + Exonic
1011640359 6:89411960-89411982 GCTGGGGAAGCCGCAGCCGCAGG - Exonic
1012399997 6:98835070-98835092 GCCCCCGCCGCCGCCGCCGTGGG - Exonic
1012400119 6:98835590-98835612 GCCGCCCCCGCCGCCCCCGCAGG + Exonic
1012939654 6:105403131-105403153 CTTGCCGCCGCCGCCGCCGCTGG - Intergenic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1013117807 6:107115542-107115564 GCGGCCGCCGCCCCCGCCCCGGG - Intergenic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013155878 6:107490561-107490583 GCTGCTGCCGCCGCCGGCGGTGG - Exonic
1013170606 6:107634266-107634288 CCTGCTGCCCCCGCCGCCTCCGG + Exonic
1013242710 6:108260928-108260950 GTAGCTGCTGCCGCCGCCGCGGG + Exonic
1013273404 6:108561604-108561626 GCTGCCACCGCCGCAGCCGGGGG + Exonic
1013575832 6:111483055-111483077 GCTGCTGCCGCCGCCTCCTCAGG + Exonic
1013793611 6:113860181-113860203 GCTGCGGCCGCCGCCGAGGCGGG + Exonic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1014137642 6:117907556-117907578 GCGGCGGCGGCCGTAGCCGCGGG + Exonic
1014230336 6:118895161-118895183 CCTGCGCCCGCCTCCCCCGCTGG - Intronic
1015148928 6:130018509-130018531 GCCGCCGCCGCCGCCGCTGCCGG - Exonic
1015251828 6:131135526-131135548 GCCGCTGCTGCCGCTGCCGCGGG + Intergenic
1015773470 6:136792004-136792026 CCAGCTGCCACCGCCGCCGCCGG - Exonic
1015965459 6:138692697-138692719 GCCCCGGCCCCCGCCGCCTCGGG + Intergenic
1016034559 6:139373423-139373445 GCTGCTGCCGCCCGAGCCGCCGG + Exonic
1016329868 6:142945113-142945135 GCTGCGGCTGCGGCGGCCGGCGG - Exonic
1016738922 6:147508455-147508477 CTGGCAGCCGCCGCCGCCGCTGG - Intergenic
1016738970 6:147508626-147508648 GCCGCCGACGCTGCCGCCGCGGG - Intergenic
1017021479 6:150143337-150143359 GCAGCGGCCGCCGTGGCCACGGG - Exonic
1017164149 6:151391525-151391547 GCTGCTGCTGCCGCCGCGGTCGG + Exonic
1017497570 6:154995328-154995350 ACTGTGGCCGCGGCCGCCGCAGG + Intronic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1017672239 6:156778731-156778753 TCCGCCTCCGCCGCCGCCGCCGG + Exonic
1017672281 6:156778840-156778862 GCCGCCGCCGCCGCCCGCGCCGG - Exonic
1017793625 6:157823034-157823056 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1018795507 6:167182149-167182171 GCCGCAGCCGCAGCCGCAGCAGG - Exonic
1018820814 6:167372914-167372936 GCCGCAGCCGCAGCCGCAGCAGG + Exonic
1019253770 7:35468-35490 GCTGCTGCCGCCGCCGCCGCCGG + Intergenic
1019261384 7:83920-83942 GCTGGGGCCTCCGCCCCTGCTGG - Intergenic
1019298497 7:291161-291183 CGCGCCGCCGCCGCCGCCGCCGG - Intergenic
1019343660 7:519754-519776 GCCTCCGCCGCAGCCGCCGCCGG + Intronic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019539953 7:1547006-1547028 GCTCCCGCCGGAGCCGCCGCTGG + Exonic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1019989562 7:4682266-4682288 GCTGCAGCCGCCGCCGCCGGAGG + Intergenic
1020418279 7:7969675-7969697 GCTGCGGCCGCCGGCGGCGTCGG - Exonic
1020727336 7:11832140-11832162 GCCGCCGCCGCCGCCGCCTCTGG + Exonic
1021451254 7:20785340-20785362 GCCGCCGCCGCCGCTGCCCCCGG + Exonic
1021452778 7:20798060-20798082 GCTGCGGCGGCCGCGGGCGCGGG + Intergenic
1022091439 7:27110352-27110374 CCTGCACCCGCCGCCGCCCCAGG - Exonic
1022107181 7:27204989-27205011 GCCGCTGCCGCGGCTGCCGCCGG - Intergenic
1022111679 7:27235983-27236005 GATGCGGCCGCTGTCCCCGCGGG - Intergenic
1022396185 7:29989683-29989705 GCTGAGGCTGCGGCCGCCGAGGG + Intronic
1022396187 7:29989689-29989711 GCTGCGGCCGCCGAGGGTGCGGG + Intronic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1023054982 7:36283980-36284002 GCTGCTGCCGCCGCCACTGGGGG - Intronic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1024082421 7:45866155-45866177 GCTGCCGCTGCCGCTGCCGCTGG + Intergenic
1025256239 7:57385544-57385566 GCAGCGGCCCCCGCCACAGCTGG + Intergenic
1025829644 7:65038264-65038286 GCGGCGGCGGCCGCGGCAGCTGG + Intergenic
1026732647 7:72925128-72925150 GCTCCAGCCGCCGCAGCCGCCGG - Intronic
1026906037 7:74063318-74063340 GCTGCGGCAGCGGCGGCGGCGGG - Exonic
1027111417 7:75442691-75442713 GCTCCAGCCGCCGCAGCCGCCGG + Intronic
1027283646 7:76627224-76627246 GCTCCAGCCGCCGCAGCCGCCGG + Exonic
1027374541 7:77537199-77537221 GCCGCCGCCGCCGCCGCCTCAGG - Intergenic
1027421156 7:78019492-78019514 GCTGCCGCCGCCGCCCGGGCCGG + Exonic
1028160167 7:87475892-87475914 GCTGGGGCCGCCGCCCACCCTGG + Intronic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028621486 7:92833566-92833588 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1029276555 7:99408556-99408578 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
1029281561 7:99438949-99438971 GCCGCCGCCGCCGCCGCCCGAGG - Intronic
1029390750 7:100272320-100272342 GCTGCTGCTGCTGCCGCCGCCGG + Intergenic
1029640413 7:101816428-101816450 GCCGCCGCCGTTGCCGCCGCGGG + Intronic
1029640537 7:101816753-101816775 GCCGCCGCCGCCGCCGCCGGTGG - Intronic
1029640538 7:101816756-101816778 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1029730126 7:102433487-102433509 GCAGCGGCTGCGGCGGCCGCGGG + Intronic
1029730130 7:102433493-102433515 GCTGCGGCGGCCGCGGGGGCGGG + Intronic
1030033163 7:105387970-105387992 GCTGCGGGCGCCGGGGTCGCGGG - Intronic
1031604144 7:123748695-123748717 GCAGCCGCCGCCGCCGCGGAGGG - Exonic
1031604229 7:123749033-123749055 GCGGCCGCCGCCGCCGCTGCGGG - Exonic
1031899309 7:127392377-127392399 GCTGCCGCCGCCACCACCGAAGG + Exonic
1031899431 7:127392842-127392864 GCTGTGCCCGCCGCGGCCGGTGG + Intronic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1031966579 7:128031739-128031761 GCGGCGGCGGCCGCAGCCCCCGG + Intronic
1031966580 7:128031742-128031764 GCGGCGGCCGCAGCCCCCGGCGG + Intronic
1032194369 7:129780818-129780840 GCCACCGCTGCCGCCGCCGCCGG + Intergenic
1033186557 7:139231793-139231815 CTTGCAGCCGCCCCCGCCGCGGG + Exonic
1033186571 7:139231835-139231857 GCAGCCGCCGCGGCCGCCGAGGG + Exonic
1033406375 7:141074037-141074059 GCTGGGTTCGCCGCCGCCGGAGG + Intergenic
1034147255 7:148884210-148884232 CGCGCCGCCGCCGCCGCCGCCGG + Exonic
1034262353 7:149764933-149764955 GCTGCGGGCGCAGACGGCGCAGG + Exonic
1034347490 7:150396559-150396581 GCTGCAGACGCTGGCGCCGCAGG + Exonic
1034347646 7:150397195-150397217 CCTGCAGCCGGGGCCGCCGCGGG + Exonic
1034522624 7:151632319-151632341 GAGGCCGCCGCCGCCGCCGCAGG + Intronic
1034522625 7:151632322-151632344 GCCGCCGCCGCCGCCGCAGGTGG + Intronic
1034618015 7:152435837-152435859 GCGGCGGCGGCCGCGGCGGCGGG - Exonic
1035169537 7:157009944-157009966 GCCGCCGCCGCCGCCGCTGGGGG - Exonic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1035169608 7:157010207-157010229 GCCGCCGCCGCCGCCACCTCCGG + Exonic
1035264891 7:157685159-157685181 GCGGCGGGCGCCCCCTCCGCCGG - Intronic
1035581041 8:738993-739015 GACGCCGCCGCCGCCGCCGCCGG + Intergenic
1035854816 8:2963369-2963391 GCTGTGTCCTCAGCCGCCGCCGG - Exonic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1036789545 8:11708835-11708857 GCAGCCGCCGCCGCCTCCGCCGG + Exonic
1037273726 8:17156504-17156526 GCCGCCGCCTCCGCCTCCGCCGG + Exonic
1037535227 8:19817436-19817458 GCCGCCGCCGCCGCCACCGCGGG - Exonic
1037879426 8:22565760-22565782 GCGGCGGCCTCGGCTGCCGCTGG + Intronic
1037887906 8:22604767-22604789 GCCGCTGCTGCCGCCGCCACCGG - Exonic
1038535725 8:28351703-28351725 GCTGCTGCTGCTGCTGCCGCAGG - Exonic
1038727615 8:30095462-30095484 GCTGCTGCCGCCGCCGCCTCGGG + Exonic
1038972069 8:32647249-32647271 GCCGCCGCCGCCACCGCCGCTGG + Intronic
1039453883 8:37695805-37695827 GCCGCCGCCGCCACCGCCGCTGG - Exonic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1039921460 8:41896784-41896806 TTCGCCGCCGCCGCCGCCGCAGG - Intergenic
1039949045 8:42153404-42153426 CCCGCGGCCTCCGTCGCCGCCGG + Intronic
1040038833 8:42896740-42896762 GCCGCCGCCGCCGCTGCCGCCGG - Intronic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1040423244 8:47260254-47260276 GCTGGGGCCGCCGCTCCCGCAGG - Intergenic
1040481426 8:47831285-47831307 GCGCCAGCCGCCGCCGCCACAGG - Intronic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041355300 8:56993636-56993658 GCTGCGGCGGCGGCGGCGGCGGG - Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1041673634 8:60516913-60516935 GCGGCCGCCGGCGCCGCCGGAGG - Exonic
1041673635 8:60516916-60516938 TCTGCGGCCGCCGGCGCCGCCGG - Exonic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1042785094 8:72537380-72537402 GCAGCGGCGGCGGCGGCCGCGGG - Exonic
1043388245 8:79768285-79768307 GCCGCCGCCGTCGCCGTCGCCGG - Intergenic
1043769714 8:84183304-84183326 GCTGCCGCTGCTGCCGCCACTGG + Intronic
1043847275 8:85177486-85177508 GCCGCCGCCGCAGCCTCCGCAGG + Exonic
1044340438 8:91040851-91040873 GCTGCTGCTGCTGCCGCCTCCGG + Exonic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045516298 8:102863629-102863651 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1046654212 8:116874720-116874742 GCTCCCGCCGCCGCCACAGCCGG + Exonic
1047493075 8:125390229-125390251 GCTGCTGCTGCCGCTGCCACCGG + Intergenic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1048244141 8:132775396-132775418 GCCGCCGCCGCCTCCGCCGCCGG - Exonic
1048889687 8:138936312-138936334 GCAGCGACCGGCGCCTCCGCAGG + Intergenic
1048981168 8:139703912-139703934 GCCGCGCCCGCCGCCCCCGGAGG - Intergenic
1049145970 8:141001239-141001261 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1049218365 8:141417889-141417911 GCTGCCGCCACCGCCGCCTGCGG - Intronic
1049405406 8:142449964-142449986 CCTCCAGCCGCCGCCGCCCCCGG - Exonic
1049427594 8:142544309-142544331 GCCGCTGCAGCCGTCGCCGCTGG + Exonic
1049639333 8:143707569-143707591 GCTGACGGCGCCCCCGCCGCAGG - Exonic
1049659964 8:143815508-143815530 GACGCGGCCGCGGCCGGCGCTGG + Intergenic
1049662159 8:143824344-143824366 ACCACTGCCGCCGCCGCCGCCGG + Exonic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1049796952 8:144501273-144501295 GCTCAGGCCGCCGCCCCCGGAGG + Exonic
1049828614 8:144685814-144685836 GCGTCCTCCGCCGCCGCCGCCGG + Intergenic
1050151287 9:2621794-2621816 TCTCCGGCCGCCGCCGGTGCGGG + Intergenic
1051170173 9:14313779-14313801 GCCGAGGCCGCCGCCGCCGCCGG + Intronic
1051170304 9:14314287-14314309 GCAGCCGCCGCCGCCCGCGCCGG + Intronic
1051351048 9:16198159-16198181 GCTGCCGCCGCCGCTGCCCTGGG + Intergenic
1051585059 9:18718633-18718655 GCTGCCGCCGCCGCTCCAGCTGG + Intronic
1052192790 9:25678178-25678200 CACGCCGCCGCCGCCGCCGCTGG + Exonic
1052295450 9:26892500-26892522 GCTGCCGCCGCTCCCACCGCCGG + Exonic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1052888869 9:33677126-33677148 GCTGCAGCCGCCGGGGCCACCGG + Intergenic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053752851 9:41273770-41273792 TGTGCAGCCGCCACCGCCGCCGG + Intergenic
1054172815 9:61856454-61856476 GCTGCCGCCGCGGCGGCGGCTGG - Intergenic
1054664725 9:67724347-67724369 GCTGCCGCCGCGGCGGCGGCTGG + Intergenic
1054775656 9:69121691-69121713 GCGGCCGCCGCCGCGGCCGGCGG - Intronic
1054775657 9:69121694-69121716 GTGGCGGCCGCCGCCGCGGCCGG - Intronic
1054775658 9:69121697-69121719 GCCGCGGCGGCGGCCGCCACCGG + Intronic
1054781993 9:69174195-69174217 GCTGACGCCGCCGCCGCCGCGGG + Intronic
1054798676 9:69325550-69325572 GCCGCTGCCGCCGCGGCCCCGGG + Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1054870294 9:70043059-70043081 GCTGCGGCAGCAGCAGCCTCTGG + Intergenic
1054906647 9:70419177-70419199 GCTGCGGCGGCGGCCGCCTGCGG - Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1055514278 9:77020633-77020655 GCGGCCGCCGCAGCCGCAGCCGG + Exonic
1056773941 9:89498043-89498065 CCAGCCGCCGCTGCCGCCGCCGG - Intronic
1057313375 9:93954986-93955008 GCAGCCGCCGCTGCCGCGGCGGG - Exonic
1057432267 9:95005039-95005061 GCTGCGTCCTCCCCGGCCGCGGG + Intronic
1057488567 9:95505904-95505926 GCGGCGGCCGCGGCCGCCGGGGG + Intronic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1057489190 9:95508557-95508579 GCTGCGGCCGCGGCCGCTGCCGG + Exonic
1057596154 9:96417761-96417783 GCGGCGGCCCCCGCGGCCCCAGG + Exonic
1057619208 9:96619746-96619768 GCAGCGGCCGCGGCCGCGGTGGG - Exonic
1057758318 9:97853932-97853954 GCCGCCGCCGCCGCAGCCGGAGG + Exonic
1058467562 9:105244657-105244679 GTAGCCGCCGTCGCCGCCGCCGG + Exonic
1058467565 9:105244660-105244682 GCCGCCGTCGCCGCCGCCGGGGG + Exonic
1058885942 9:109321021-109321043 GCCGCCGCCGCCGCTGCCGCCGG + Intergenic
1059483711 9:114611526-114611548 GCCGCCGCCGCCGCCACCCCGGG - Exonic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1059769832 9:117414794-117414816 GCTGCCGCCGCCGCCGCTGCTGG - Exonic
1060346077 9:122816897-122816919 GCTGAGGCCGCCACTGCTGCTGG + Intronic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060700482 9:125746560-125746582 GCGCCTCCCGCCGCCGCCGCCGG - Intergenic
1060700546 9:125746770-125746792 GAAGTCGCCGCCGCCGCCGCCGG - Intergenic
1060714849 9:125915808-125915830 GCTGCAGCCGCGGCAGCCTCTGG + Exonic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1061365790 9:130172100-130172122 GCTCCGGCCCCCGCCGCGGCGGG - Intergenic
1061365987 9:130172633-130172655 GCCGCGGCCCCCGCCCCCCCGGG - Exonic
1061541080 9:131278038-131278060 GCCGCCGCCGCCGCCGCCTGCGG - Intergenic
1061575470 9:131503325-131503347 GCTGGGGCCGACGCAGCCTCGGG + Intronic
1061853310 9:133428660-133428682 GCTGGGGCCGCAGCCGCTGCCGG - Exonic
1062022595 9:134326513-134326535 GCCGCCGCCACCGCAGCCGCCGG + Intronic
1062022619 9:134326558-134326580 GCGGCGGCCCCCGGCGCGGCCGG - Exonic
1062491676 9:136807982-136808004 GCTCCGGCCCCCGCGGCCTCCGG - Exonic
1062542068 9:137045932-137045954 GCAGCAGCCGCAGCAGCCGCAGG + Exonic
1062544075 9:137053955-137053977 ACTGCTGCCGCCGCTGCTGCTGG - Exonic
1062560407 9:137139195-137139217 GGAGCCGCCGCCGCCGCCGCCGG + Intronic
1062579206 9:137222093-137222115 GCGGCCGCCGCCGGAGCCGCCGG - Intergenic
1062624185 9:137435537-137435559 GCTGTGGCCACGGCCGCAGCTGG - Intronic
1062629969 9:137459143-137459165 CCCGCGCCCGCCGCCTCCGCCGG + Exonic
1062659136 9:137619185-137619207 GCCGCCGCTGCCGCCGCCTCAGG + Intronic
1062746626 9:138217075-138217097 GCTGCTGCTGCCGCCGCTGCCGG - Intergenic
1203770878 EBV:49522-49544 GCTCAGGCCGCCGCATCCGCTGG + Intergenic
1185641541 X:1591726-1591748 TCCCAGGCCGCCGCCGCCGCTGG - Exonic
1186496375 X:10015309-10015331 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1186496467 X:10015599-10015621 GCTGTCCCCGCCGTCGCCGCCGG - Exonic
1186829855 X:13379303-13379325 GACTGGGCCGCCGCCGCCGCTGG + Intergenic
1187067462 X:15854722-15854744 TTCGCCGCCGCCGCCGCCGCCGG - Exonic
1187172913 X:16869736-16869758 GCGGAGGCGGCCCCCGCCGCTGG - Exonic
1187172915 X:16869742-16869764 GCGGGGGCCGCCTCCGCCCCGGG + Exonic
1187281539 X:17861234-17861256 GCTGTCGCCGCCGCCGCTGCTGG + Exonic
1187507210 X:19887496-19887518 GCTGCTGCCGCTGCTGCCCCGGG + Exonic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1187547312 X:20266715-20266737 GCCGCCGCCGCCGCTGCCGTGGG - Exonic
1187825797 X:23333286-23333308 GCCGTTCCCGCCGCCGCCGCAGG + Intergenic
1187826178 X:23334758-23334780 GCCGCCGTCGCCGCCGCCGCGGG + Exonic
1188691198 X:33131188-33131210 GCTGCGGCTGCTGCTGCTGCTGG + Intronic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1189407113 X:40735350-40735372 GCTGCCCCCGCCGCCGCCTCCGG + Exonic
1189446427 X:41085400-41085422 GCCGCTACCGCCGCCGCCACTGG + Intergenic
1190008058 X:46758942-46758964 GCTGCTGCTGCCGCTGCTGCTGG - Exonic
1190337462 X:49270769-49270791 GCTGCGGCAGCTGCTGCTGCTGG - Exonic
1190542864 X:51496501-51496523 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1190745603 X:53320458-53320480 GCTGTGGCCTCCGCCGGCGCCGG + Exonic
1191830208 X:65407590-65407612 GCCTCGCCCGCCGCCGCCTCGGG + Intronic
1192361754 X:70445113-70445135 ACCACCGCCGCCGCCGCCGCCGG - Exonic
1192657042 X:73003193-73003215 GCCACGGTCGCCGCTGCCGCCGG - Intergenic
1192665078 X:73079808-73079830 GCCACGGTCGCCGCTGCCGCCGG + Intergenic
1192925022 X:75747168-75747190 GCCGCCGCCGCCGCCACCTCCGG + Intergenic
1194325874 X:92515501-92515523 GCTGTAGCCGCCGCCGCCGCGGG + Intronic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1194977596 X:100409724-100409746 GCCGCCGCCGCCGCCGCGGGAGG + Exonic
1195803260 X:108735674-108735696 GCTGCCGCCGCCAGCGCGGCCGG + Exonic
1196214623 X:113035928-113035950 GCTGCTGCTGCCGCCACTGCTGG + Intergenic
1196684023 X:118495703-118495725 GCTGCCGCCGCCGACGCCGTGGG + Intergenic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1196871245 X:120115607-120115629 GCAGCAGCCGCAGCCCCCGCCGG - Exonic
1197754469 X:129984227-129984249 GCCGCCGCCGCCGCCGCTTCTGG + Intronic
1197766152 X:130060565-130060587 GAGGCGGCCGCGGCCGCGGCTGG - Intergenic
1197962868 X:132024092-132024114 GCCGCCGCCGCCGCCACCCCTGG - Intergenic
1197980978 X:132217856-132217878 GAGGCGGCGGCCGGCGCCGCAGG - Intronic
1198158511 X:133985356-133985378 GCAGCCCCCGCCGCCGCCGCCGG - Exonic
1198276332 X:135098371-135098393 TCCGCGGCCGCCGCCGCCGCCGG + Intergenic
1198310177 X:135422372-135422394 GCCTTCGCCGCCGCCGCCGCCGG - Intergenic
1198807149 X:140503985-140504007 GCTGCGGCCGCGGCGGTGGCGGG + Exonic
1198807171 X:140504066-140504088 GCCGCGGCCGCCGCCGCCTCGGG - Exonic
1199136591 X:144261049-144261071 GCCGCCGTCGCCGTCGCCGCCGG + Intergenic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic
1199500410 X:148500793-148500815 GCTGCGGCGGCAGCCGCTGCGGG - Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1199772739 X:150984398-150984420 GCTGTCGCCGCCGCCCGCGCCGG + Intronic
1200093867 X:153648204-153648226 GCGGGGGCCGGCGCCGGCGCGGG + Exonic
1200100650 X:153687984-153688006 GCGGCTGCAGCCGCCGCCGCCGG + Intronic
1200128919 X:153830670-153830692 GCCGCTGCCGCTGCCGCCTCCGG + Intergenic
1200155580 X:153972934-153972956 GCCGCCGCCGCCGCCGCGCCCGG - Intronic
1200277860 X:154751159-154751181 CCTCCGGCCGCCGCGGCCCCCGG + Intronic
1200292661 X:154887037-154887059 ACTGCCGCCGCCCCCGCCGCCGG + Exonic
1200339505 X:155382777-155382799 ACTGCCGCCGCCCCCGCCGCCGG + Exonic
1200346965 X:155457916-155457938 ACTGCCGCCGCCCCCGCCGCCGG - Exonic
1200634596 Y:5634659-5634681 GCTGTAGCCGCCGCCGCCGCGGG + Intronic