ID: 1031968831

View in Genome Browser
Species Human (GRCh38)
Location 7:128048915-128048937
Sequence CCGTGTGAACAGCTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031968831_1031968835 17 Left 1031968831 7:128048915-128048937 CCTTCTTCCAGCTGTTCACACGG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1031968835 7:128048955-128048977 CTTCCTGTCTCCAAAAGAGCAGG 0: 1
1: 0
2: 1
3: 57
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031968831 Original CRISPR CCGTGTGAACAGCTGGAAGA AGG (reversed) Intronic
903003327 1:20281896-20281918 CCCTTTGAACAGCTGGGAGCTGG + Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
909043090 1:70676879-70676901 CCTTGTGACCTGCAGGAAGATGG + Intergenic
911331961 1:96535030-96535052 CTGTTTGAACTGCTTGAAGATGG + Intergenic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
917340509 1:173972591-173972613 ACTTGGGAACAGCTGGAAAATGG - Exonic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918703740 1:187636756-187636778 CAGTCTGAACAGCAGAAAGAGGG + Intergenic
918927422 1:190806434-190806456 CCTGGGGAATAGCTGGAAGATGG - Intergenic
920545455 1:206812698-206812720 CCGTGTGAGGTGCTGGATGAAGG + Intronic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
1062919764 10:1271034-1271056 CTGTGTGACCAGCTGGGATATGG + Exonic
1065198496 10:23290118-23290140 CCATCTGAACAGCAGGAAGAAGG - Intronic
1067558071 10:47286025-47286047 CCGTGTGCAGAGCAGGCAGAGGG + Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1070094643 10:73324706-73324728 CGATGTGATCAACTGGAAGAAGG + Intronic
1070306511 10:75242673-75242695 TGGTGTGCACATCTGGAAGATGG - Intergenic
1072871878 10:99128628-99128650 CAGTGAGAACACCTGGAACAGGG + Intronic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1075087296 10:119422160-119422182 CCCTGGGAACAGCTGGCAGAGGG + Intronic
1076379882 10:130017677-130017699 GCGTGTGATCACCTGGGAGAGGG - Intergenic
1076468513 10:130702513-130702535 ATGTGTGCACAGCTGGCAGAGGG + Intergenic
1076773270 10:132678875-132678897 CCATGTGAGAAGCTGGAAAAGGG + Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1084215115 11:67642883-67642905 CCCACTGAACATCTGGAAGATGG + Exonic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089397543 11:118145895-118145917 CCCTGGGAACCGCAGGAAGACGG + Intronic
1090024560 11:123156619-123156641 CATTTTGTACAGCTGGAAGAAGG + Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091880398 12:3972621-3972643 CCATGTAAGCATCTGGAAGAAGG + Intergenic
1094120639 12:26970370-26970392 CCGTGTGAAGAGCAGTAAGAGGG - Intergenic
1102966228 12:117129813-117129835 CCCTGGAAACAGCTAGAAGAAGG - Intergenic
1106554346 13:30797284-30797306 CAGTGTGAAACGCTGGAGGAGGG + Intergenic
1108935188 13:55873793-55873815 CCATGTGAACAGCTGAATGGGGG - Intergenic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1112753336 13:102604052-102604074 CAGTGTGAACAGCTGGGCGTGGG + Intronic
1113170252 13:107493337-107493359 TCGTGTGAACTCCTGGAAGCAGG + Intronic
1114970443 14:28020369-28020391 CCTTGAGGACAGCTTGAAGATGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127315089 15:57787633-57787655 CCCTGTGAAGAGCTATAAGATGG - Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1131564689 15:93475369-93475391 TCGTGTGAACCGCTGGGAGCAGG + Intergenic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132813370 16:1813032-1813054 CCGTGTGAACACCCAGGAGAAGG - Intronic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1133266592 16:4588274-4588296 CCATGAGGACAGCTGGAAGAAGG + Exonic
1135724265 16:24842659-24842681 CCCAGTGAACAACTGGAAGAGGG - Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141859158 16:86704724-86704746 CTGTGTGAACAGCTCCATGAGGG - Intergenic
1143012528 17:3873739-3873761 CCGTGTGACCCTCTGGATGAAGG - Intronic
1143471418 17:7178223-7178245 GTGTGGGAACAGCTGGAAGCTGG - Intronic
1144950600 17:18991638-18991660 CCATGTGAGCAGCTGGCACAGGG + Intronic
1146400232 17:32495632-32495654 TCGTGTGAGGAGCTGGAGGAAGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149529433 17:57383017-57383039 GCCTGTGAACAGCAGGAACAGGG + Intronic
1151230097 17:72678325-72678347 CCCTGTGAACAGCGAGAAGGAGG + Intronic
1152142964 17:78549319-78549341 CCGTCTGCACACCAGGAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1157439817 18:47702152-47702174 CAGTGTGATCATCTGGAAAATGG + Intergenic
1159495829 18:69203148-69203170 CCATGTGGACAGCTGAAAGCTGG + Intergenic
1159917386 18:74199029-74199051 CCGGGTGAACTGCTGGAGGGAGG + Intergenic
1163029500 19:14534999-14535021 CAGTGTGGACTGCTGGGAGAGGG + Intronic
1163075480 19:14887195-14887217 CCGTGTGGACCCCTGGAAGCAGG - Intergenic
1165717862 19:38058227-38058249 CCGAGGGACCAGCTGGCAGATGG - Intronic
1167403534 19:49288893-49288915 CCGTGAAAGCAGCTGGAAGGGGG + Intergenic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
928216843 2:29368805-29368827 CCCTGAGAACAGATGGATGATGG - Intronic
928681643 2:33708741-33708763 CCGAGTGATCAGATGCAAGAGGG + Intergenic
928922183 2:36537625-36537647 CCGTGTGAACGAATGAAAGAAGG - Intronic
929509369 2:42554876-42554898 CCTTTTAATCAGCTGGAAGAAGG - Intronic
932147227 2:69332970-69332992 CCATGTGAGCAGCTGGAGGCTGG - Intronic
935668670 2:105536608-105536630 GCGTGTGAACAGCTGGGAGCTGG + Intergenic
938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG + Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
942570967 2:177313850-177313872 CCATTAGAAGAGCTGGAAGAAGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
1172779138 20:37425352-37425374 TCCTGGGAGCAGCTGGAAGAAGG + Intergenic
1172931382 20:38588560-38588582 CCCATTGAACAGATGGAAGAGGG - Intergenic
1174394685 20:50239677-50239699 GCCTGGGAATAGCTGGAAGAAGG + Intergenic
1176877717 21:14149860-14149882 CCATGAAAGCAGCTGGAAGAGGG - Intronic
1177283165 21:19011641-19011663 CAGTGTTAACATTTGGAAGAGGG - Intergenic
1178222930 21:30681508-30681530 CCTTGTCACCATCTGGAAGATGG + Intergenic
1180018653 21:45104665-45104687 CCCTGTGAAGGGCTGGAAGCAGG + Intronic
1180946454 22:19696337-19696359 CGGCGTGACCAGCTGGATGATGG - Intergenic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
950020896 3:9787055-9787077 CAGCATGAACAGCCGGAAGATGG - Exonic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
956900782 3:73713747-73713769 CCATGTGAATATCTGGAGGAAGG - Intergenic
958984245 3:100761948-100761970 CTGTTTGAATAACTGGAAGATGG - Intronic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
962281142 3:134052778-134052800 CTGTGTGAAGCGGTGGAAGAAGG + Intergenic
963442399 3:145356484-145356506 CAGTATGAACAGCAGAAAGAGGG - Intergenic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
966097922 3:176228515-176228537 CCATGAGAACAGCTGGAGGCAGG + Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
970351854 4:15209502-15209524 CCATGTGAAATGCAGGAAGAGGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
980633223 4:135465708-135465730 CAGTGAGAACAGCTGTTAGAAGG + Intergenic
980706768 4:136507232-136507254 CCGTGTGAACAAGAGGATGATGG + Intergenic
981374451 4:143997483-143997505 CAGTGTGAACAGCTCTAGGAGGG - Intronic
981384775 4:144116797-144116819 CAATGTGAACAGCTCTAAGAGGG - Intronic
987634738 5:20525516-20525538 CCAGGTGAACTGCAGGAAGAAGG - Intronic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
993593686 5:89826673-89826695 CAGAGAGAAAAGCTGGAAGATGG + Intergenic
1003330945 6:5128322-5128344 CCCTGTGTACAGCTGGGAGCAGG - Intronic
1005405755 6:25486087-25486109 CAGTGTTTACAGCTGGAAAAAGG - Intronic
1008640549 6:53458139-53458161 CAGTGTCATCAGCTGGAACATGG + Intergenic
1009890924 6:69680869-69680891 TCAGGTGAGCAGCTGGAAGATGG - Intronic
1014401902 6:121000201-121000223 TCTTGTGAGCAGCTGGTAGAAGG - Intergenic
1016289270 6:142510258-142510280 CCGTATGAACTGCTGGAAGGGGG - Intergenic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1018366832 6:163129650-163129672 CCCTGTGATCAGTAGGAAGATGG - Intronic
1019515672 7:1438873-1438895 CCGAGTGCAGAGCTGGAAGGAGG - Exonic
1021192465 7:17637420-17637442 CCATGAGAACAGCAGGAGGATGG + Intergenic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022965191 7:35465874-35465896 CCGGGTGACCTGCTGGAAGTGGG - Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024251905 7:47511982-47512004 CCATGGGAACAGGTGGAACAAGG - Intronic
1026489149 7:70847843-70847865 CAGTATGAACAGCAGAAAGAGGG + Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1035091789 7:156319050-156319072 CCGTGTGTTTAGCTGGATGACGG - Intergenic
1036981533 8:13474584-13474606 CCGTGAAAGCAGCTGGGAGAGGG + Intronic
1038090067 8:24242460-24242482 ACTTGTGAGCAGCTGAAAGAGGG + Intergenic
1038686392 8:29722585-29722607 CACTGTGGAAAGCTGGAAGAAGG + Intergenic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1038864005 8:31419067-31419089 CCAGGGCAACAGCTGGAAGAGGG - Intergenic
1041999374 8:64103595-64103617 CAATGTGATCAACTGGAAGAAGG + Intergenic
1045272342 8:100672749-100672771 CCATATGAACTGCTGGAAGATGG - Intergenic
1048008408 8:130437769-130437791 CCGTGGGCACAACAGGAAGAAGG - Intronic
1048821829 8:138387333-138387355 GCGTGTGTACTGCTGGAAGTAGG - Intronic
1049285905 8:141775074-141775096 CCGTGTGAACAGATGGGGAAGGG + Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1053476031 9:38382516-38382538 CCGTGTGAACAGATAGACAACGG + Intergenic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1056640810 9:88368851-88368873 CCGTGTGCACATTAGGAAGATGG + Intergenic
1056926086 9:90835562-90835584 TCCTGTGCACAGTTGGAAGACGG + Intronic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1058944535 9:109843784-109843806 CGGTGTGAACAGCTGGGATGGGG - Intronic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1062277974 9:135739574-135739596 CGGTGTGAACACCATGAAGAGGG - Intronic
1185750791 X:2608786-2608808 CCCCGTGAGCAGCTGGAAGGGGG + Intergenic
1187738798 X:22332696-22332718 CCATGTTAACATCTAGAAGATGG + Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1194957148 X:100194379-100194401 CAGTATGAACAGGTGCAAGAAGG - Intergenic
1194993586 X:100570414-100570436 CCGTGTGAACAGCAGAATGGGGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197581950 X:128294572-128294594 CCGTGAAAGCAGCTGGGAGAAGG + Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199170892 X:144733374-144733396 CCGTGAAAACAGCTGGGAGGGGG - Intergenic
1201494152 Y:14575360-14575382 CGATGTGATCAACTGGAAGAAGG - Intronic