ID: 1031970060

View in Genome Browser
Species Human (GRCh38)
Location 7:128058120-128058142
Sequence CCTAGCACTGGCAAGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031970060_1031970068 8 Left 1031970060 7:128058120-128058142 CCTGACCCCTTGCCAGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1031970068 7:128058151-128058173 CTGGGCTATGCATCAGCCAAAGG 0: 1
1: 0
2: 2
3: 11
4: 97
1031970060_1031970067 -10 Left 1031970060 7:128058120-128058142 CCTGACCCCTTGCCAGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 207
Right 1031970067 7:128058133-128058155 CAGTGCTAGGCAAACAAGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031970060 Original CRISPR CCTAGCACTGGCAAGGGGTC AGG (reversed) Intronic
900569446 1:3351184-3351206 GCTGGCACTGGCCAGGGGCCGGG - Intronic
901744660 1:11364256-11364278 CCTTGCTCTGGGCAGGGGTCAGG + Intergenic
901960108 1:12819552-12819574 CCTGGGAAGGGCAAGGGGTCAGG - Intergenic
905489915 1:38335223-38335245 CCCAGGACTGGCAAGGGCACTGG + Intergenic
905889842 1:41512129-41512151 CATATCACTTGCAAGGGGTGTGG - Intronic
911434546 1:97839835-97839857 TCTAGCACTGGCAAAGTTTCAGG - Intronic
914689825 1:150015836-150015858 TCAAGCACTGGCAAGGGGAAGGG - Intergenic
918459800 1:184764962-184764984 CCTATCACTGGCAAGACCTCAGG - Intergenic
918684328 1:187396703-187396725 CCCAGGAAGGGCAAGGGGTCGGG + Intergenic
919526741 1:198662985-198663007 TCTTGCTCTGGCCAGGGGTCAGG - Intronic
919926432 1:202194094-202194116 CCTGGCAGTGGCAGGGGGCCGGG - Exonic
922608821 1:226909092-226909114 CCAATCACTGGCAATGGGTGTGG + Intronic
1063268429 10:4479701-4479723 CAGGGCACTGGCAAGGGCTCTGG + Intergenic
1063588075 10:7370936-7370958 CCTTGGACTGGCCAGGCGTCGGG - Intronic
1064290587 10:14030709-14030731 CCTGGCACTGGCCTGGGATCAGG + Intronic
1064392552 10:14954247-14954269 CCTTGCACTGGGCAGGGCTCAGG - Intronic
1067103821 10:43351617-43351639 CCCAGCGCTGGGCAGGGGTCTGG - Intergenic
1067265206 10:44735787-44735809 CATAGCACTGGGAAGGGTTTTGG - Intergenic
1067462523 10:46468260-46468282 CCTAGCAGAGGCAAAGGGTCTGG - Intergenic
1067624672 10:47916377-47916399 CCTAGCAGAGGCAAAGGGTCTGG + Intergenic
1069645964 10:69997885-69997907 CATGGCACTGGCAAGGACTCAGG + Intergenic
1071244441 10:83747133-83747155 CCTGGGAAGGGCAAGGGGTCAGG - Intergenic
1071524478 10:86350234-86350256 TGCAGCCCTGGCAAGGGGTCTGG + Intronic
1072869180 10:99099204-99099226 CCCAGCAAGTGCAAGGGGTCAGG + Intronic
1076534418 10:131167641-131167663 CCTGGCCCTGCCAAGGGGACAGG + Intronic
1077655713 11:4017009-4017031 CCTGGCAAGTGCAAGGGGTCAGG - Intronic
1078317094 11:10303283-10303305 CCTGGCCCTGGTAAGGGGTTGGG - Intergenic
1078571900 11:12465986-12466008 CTAAACACTGGCAAGGGGTGTGG - Intronic
1078681401 11:13480132-13480154 CCTAGGAAGTGCAAGGGGTCAGG + Intergenic
1079681579 11:23303975-23303997 CCTGGGAAGGGCAAGGGGTCAGG - Intergenic
1081691332 11:45080500-45080522 CCTGCCACTGGAGAGGGGTCTGG - Intergenic
1083603914 11:63965669-63965691 CCCAACACAGGCAAGGGGCCTGG - Intergenic
1083999053 11:66286184-66286206 CTCAGCACTGGCTAGGGCTCTGG + Intronic
1085128509 11:74018284-74018306 CCCATCCCTGGCAAAGGGTCAGG + Intronic
1090306170 11:125693098-125693120 CCTAGCCCTGGGCAGGGGGCAGG + Intergenic
1090688800 11:129155955-129155977 CCTGGGAAGGGCAAGGGGTCAGG + Intronic
1094155884 12:27336369-27336391 CCTGCCACTGGGAAGGGGTGAGG - Intronic
1095128279 12:38508058-38508080 CCCAGGAAGGGCAAGGGGTCGGG + Intergenic
1096241678 12:49963109-49963131 GCTGGCACTGGCATGGGGCCAGG + Intronic
1096879376 12:54655042-54655064 CCTAGAGGTGGCAGGGGGTCAGG + Intergenic
1097985112 12:65774917-65774939 TCTAGCACTGGCTAAGGGTTGGG + Intergenic
1099302883 12:80919706-80919728 CCTACCACTGGAAAGGGGCAGGG + Intronic
1102012893 12:109629635-109629657 CCCAGCACCGGCACAGGGTCTGG + Intergenic
1114930979 14:27466684-27466706 GCTAGTGCTGGCATGGGGTCTGG - Intergenic
1115974479 14:38981447-38981469 CCCGGGAATGGCAAGGGGTCAGG - Intergenic
1116198366 14:41757686-41757708 CCTGGCAAGCGCAAGGGGTCAGG - Intronic
1118571807 14:67201598-67201620 CCAGTCACTGGCAAGGGGTGTGG + Intronic
1122011053 14:98747699-98747721 CCAAGTACTGGCAAGGGTGCAGG + Intergenic
1122984938 14:105207680-105207702 CCTGGCACTGGGAAGGGCCCAGG + Intergenic
1125062709 15:35443435-35443457 TCTACCACAGGCAAGGGGTCTGG + Intronic
1125796062 15:42404785-42404807 CCTGGCACTGGCTCAGGGTCAGG - Intronic
1126109906 15:45169024-45169046 TCAAGCACAGGCAAGGGGTGAGG + Intronic
1127317956 15:57815357-57815379 CCCAGCAAGTGCAAGGGGTCAGG - Intergenic
1131514784 15:93070065-93070087 CCCTGCACTGTCAAGCGGTCTGG - Intronic
1131584098 15:93674989-93675011 CCTATCATTGGCAAGAGGTCAGG + Intergenic
1132413354 15:101602716-101602738 CATGGCACTGGCCAGGGGCCTGG + Intergenic
1133698870 16:8290341-8290363 CATGGCAGTGGGAAGGGGTCAGG - Intergenic
1134189680 16:12111548-12111570 CCTTGCAGTGGGAAGGGGCCGGG - Intronic
1135905224 16:26505871-26505893 CCTAGCAATGGCATGGACTCAGG + Intergenic
1136717030 16:32289317-32289339 TCTAGGACTGGCAAGGCGCCCGG + Intergenic
1136835407 16:33495562-33495584 TCTAGGACTGGCAAGGCGCCCGG + Intergenic
1137379475 16:47984017-47984039 TCTACCACTTCCAAGGGGTCAGG + Intergenic
1139271751 16:65690195-65690217 CCTGGGAAGGGCAAGGGGTCAGG + Intergenic
1139383696 16:66550240-66550262 CCTAGCAGTGGTAAGGCTTCTGG - Exonic
1140984208 16:80142240-80142262 CCTAGGAAGTGCAAGGGGTCAGG - Intergenic
1141618161 16:85221810-85221832 CCCAGCCCCGGCAAGGGGTAGGG - Intergenic
1142246151 16:88970961-88970983 CATAGCACAGGCACGGGCTCGGG + Intronic
1203009396 16_KI270728v1_random:228470-228492 TCTAGGACTGGCAAGGCGCCCGG - Intergenic
1203145579 16_KI270728v1_random:1795884-1795906 TCTAGGACTGGCAAGGCGCCCGG + Intergenic
1147256812 17:39186491-39186513 CTTACCACTGGCAGGGGGTGTGG + Exonic
1152229823 17:79108856-79108878 CCTGGCACTGGCAGTGGGGCAGG + Intronic
1152555191 17:81049555-81049577 CCCAGCACTGTCAGGGCGTCTGG + Intronic
1152788891 17:82267466-82267488 CGCAGCAGTGGCAAGGGGTTTGG - Intronic
1153954350 18:10083423-10083445 CCTAACTCTGGCTGGGGGTCAGG + Intergenic
1154340856 18:13500991-13501013 CCTAGCAGTGACAATGGGTTTGG - Intronic
1155876956 18:31101006-31101028 CCCAGCTCTGGGAAGGGGTAGGG + Intronic
1158106891 18:53895542-53895564 CCTAGACCTGGGAGGGGGTCCGG - Intergenic
1158162103 18:54496735-54496757 CCTATCACTGGCAAGGAGAGTGG + Intergenic
1158498994 18:57983236-57983258 CCTTGCAATGGCCAGGGGTGAGG + Intergenic
1158745302 18:60193097-60193119 CTTGGCACTGGCAAGGTGTAAGG + Intergenic
1163129041 19:15260612-15260634 CCTAGTGCAGGCAAGGGGTGGGG - Intronic
1163378209 19:16947264-16947286 CCAGGCACTGGGAGGGGGTCTGG - Intronic
1164589170 19:29496662-29496684 CCTGGCAGTGGCCAGGGGACTGG - Intergenic
1165981647 19:39729240-39729262 CCTGGCAAAGGCAAGGGGCCTGG - Intergenic
1167049008 19:47067512-47067534 CCCAGCAGTTCCAAGGGGTCTGG - Exonic
926349184 2:11980003-11980025 TCTAGCACTGACAAGGGATAGGG + Intergenic
927096357 2:19750339-19750361 CCAAGCACTGGCTAGGGACCAGG + Intergenic
927716113 2:25354392-25354414 CCCAGCTCTGGCAATGGGTTTGG + Intergenic
929188641 2:39120563-39120585 GCTAGCCCTGGCGAGGGGGCTGG + Intronic
932420627 2:71599323-71599345 CCCAGCACTGGAAATGGGACTGG + Intronic
933024493 2:77237892-77237914 CCTACCACTGGCCATGGGGCTGG + Intronic
933603101 2:84353819-84353841 CCCAGGAATTGCAAGGGGTCAGG + Intergenic
935604764 2:104959554-104959576 CCCAGGAAGGGCAAGGGGTCTGG - Intergenic
936260032 2:110950866-110950888 CCAGGGACTGGGAAGGGGTCTGG + Intronic
936933271 2:117812276-117812298 CCTAGCCTTGGGAAGGGGTCTGG - Intergenic
937284836 2:120743738-120743760 CCTATCTCTGGGAAGGGGGCGGG + Intronic
937905880 2:127052532-127052554 CCTACCACTGTCAAAGGGACAGG + Intronic
940079711 2:149787433-149787455 CCTTGCACTGGCAAGATATCAGG - Intergenic
940729039 2:157368732-157368754 CCTGGGAAGGGCAAGGGGTCAGG + Intergenic
941966899 2:171309833-171309855 CCTAGCTCTCACCAGGGGTCCGG - Intergenic
946659526 2:221984758-221984780 CCTGGGAATTGCAAGGGGTCAGG + Intergenic
946738728 2:222780542-222780564 CCTAGCAATGTCAAGGGTTATGG + Intergenic
1169317096 20:4601832-4601854 CCCTGCACTGGCACGGGGCCAGG - Intergenic
1169397119 20:5241976-5241998 CCTAGGAAGTGCAAGGGGTCAGG - Intergenic
1170740057 20:19048199-19048221 CCTAGCAATGCCACGTGGTCAGG - Intergenic
1171481434 20:25458470-25458492 CCCAGCACTTGCAGGAGGTCCGG - Exonic
1174013023 20:47465966-47465988 CCAACCACTGACAAGTGGTCTGG + Intergenic
1174081512 20:47973546-47973568 CCCAGCACTGGCTTTGGGTCAGG - Intergenic
1174134986 20:48373340-48373362 CCCAGCACTGGCTTTGGGTCAGG + Intergenic
1179919405 21:44499528-44499550 GCGAGCACTGGCAGGGGCTCTGG + Exonic
1181243732 22:21491811-21491833 CCTGAGACTGGCAAGGGGACTGG + Intergenic
1184995994 22:48208040-48208062 CCTAGCTCAGCCAAGAGGTCAGG + Intergenic
950131766 3:10552178-10552200 CATAGCACTGGCGAGGGGCGTGG + Intronic
950536447 3:13581732-13581754 TGAAGCACTGGCACGGGGTCTGG - Intronic
950963076 3:17125866-17125888 CCTAACACTGCCAAGGCCTCAGG + Intergenic
951610873 3:24491777-24491799 CTTAGCACTGGCAATGCTTCTGG + Intronic
953083012 3:39638721-39638743 CCTACCTCTGGGAAGGGGTAAGG - Intergenic
953186121 3:40639888-40639910 CATAGCACTGGGGAGGGGTTTGG - Intergenic
954418116 3:50404050-50404072 CCCATCACAGTCAAGGGGTCAGG + Intronic
958618453 3:96526846-96526868 CCCAGGAAGGGCAAGGGGTCAGG + Intergenic
965200770 3:165655328-165655350 CCCAGGAAGGGCAAGGGGTCGGG + Intergenic
967224440 3:187277212-187277234 CCTGGCAGTGGAAAGGGCTCTGG - Intronic
967339288 3:188378642-188378664 CCCAGGAATTGCAAGGGGTCAGG - Intronic
967372598 3:188764698-188764720 CCTAGCATTACCAAGGAGTCTGG + Intronic
967986793 3:195101174-195101196 CATAGCACTGGCAAGAGGCCTGG - Intronic
968464389 4:743209-743231 CCTAGGACAGGCACGGGGCCTGG - Intronic
968703312 4:2066802-2066824 CCTAGCACTGCTCAGGGGCCTGG + Exonic
970095772 4:12461495-12461517 CCTGGGAAGGGCAAGGGGTCAGG + Intergenic
970796570 4:19920332-19920354 CCTAGGAAGTGCAAGGGGTCAGG + Intergenic
975991970 4:80266919-80266941 CCTATCAGTGGCAGCGGGTCCGG - Exonic
976370738 4:84285814-84285836 CCCAGGAAGGGCAAGGGGTCAGG + Intergenic
977698937 4:99999341-99999363 CCTAGCACTGAAAATGGTTCAGG - Intergenic
979359081 4:119740683-119740705 CCTAGCACTTGGAGGGGGTGAGG - Intergenic
980040603 4:127935167-127935189 CCTACCCCTGGCAAAGGTTCTGG - Intronic
982330747 4:154179294-154179316 CCTACCAGTTGCTAGGGGTCTGG + Intergenic
982571599 4:157057420-157057442 CCTTGCTCTGGCAAGGGGAGGGG - Intergenic
982883248 4:160746545-160746567 CCTGGCAAGTGCAAGGGGTCTGG + Intergenic
983949528 4:173622819-173622841 CCTGGGAAGGGCAAGGGGTCAGG - Intergenic
988856507 5:35232693-35232715 CCCAGCACTGGCACTGGGTTAGG + Intergenic
990038216 5:51348863-51348885 CCTGGGAAGGGCAAGGGGTCAGG + Intergenic
990071781 5:51791079-51791101 CCTGGGAAGGGCAAGGGGTCAGG - Intergenic
990131522 5:52591668-52591690 CCTATCACTGTGAAGGGGTGAGG - Intergenic
993792971 5:92230177-92230199 CTCAGCAGTGGCAATGGGTCTGG - Intergenic
993881854 5:93372273-93372295 CCTAGGACTTGCAAGGCCTCAGG + Intergenic
994424277 5:99563681-99563703 CCTAGGAAGTGCAAGGGGTCAGG - Intergenic
994789855 5:104209917-104209939 CATAGAAGTGGAAAGGGGTCAGG - Intergenic
995213761 5:109571288-109571310 CCAACCACTGGCAAGGGGAATGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
995536742 5:113144036-113144058 CCTAGCACCGGCAAATGGCCTGG + Intronic
995768113 5:115640568-115640590 CATAGCACTGGCAAGAGCCCAGG - Intergenic
996183685 5:120451183-120451205 CCAGGCACTGGCATGGGCTCTGG + Intergenic
997694744 5:135852144-135852166 CCAGGCACTGGCCAGGGGCCAGG - Intronic
998135604 5:139672851-139672873 CCTAGGACTGGCTAGGGAACTGG - Intronic
1002026645 5:176400479-176400501 CCCAGCTCTGGCAAGGGGTGGGG - Intronic
1002910468 6:1487427-1487449 CCCAGCACTGAGAAGGGGCCAGG + Intergenic
1004457566 6:15805081-15805103 CCTAGCCCTGGAGAGAGGTCAGG - Intergenic
1006385349 6:33727664-33727686 CCTAGCAGTTGGAAGGGGCCAGG - Intronic
1006447836 6:34089879-34089901 CCTAGCACTTGCACAGGGGCTGG + Intronic
1006582371 6:35084348-35084370 CCAGGCACTGGCCAGGGGCCAGG - Intronic
1007702300 6:43772159-43772181 CCTAGCACTGGGCAGAGGTAGGG - Intronic
1008566839 6:52777154-52777176 CCTAGGAAGTGCAAGGGGTCAGG - Intergenic
1008619738 6:53260032-53260054 CCCAGCACTGGCAAGATGCCTGG + Intergenic
1009943579 6:70317761-70317783 CCCAGGAAAGGCAAGGGGTCAGG + Intergenic
1011564314 6:88658439-88658461 CCCAGCACTAGCCAGGGGCCAGG + Intronic
1012791921 6:103709225-103709247 CCTGGGACGCGCAAGGGGTCAGG + Intergenic
1014842938 6:126241138-126241160 CCCAGGAAGGGCAAGGGGTCAGG - Intergenic
1015046312 6:128780182-128780204 CCCAGGATGGGCAAGGGGTCGGG - Intergenic
1015572505 6:134636090-134636112 CCAAGCTCTGGGAAGGGGTTGGG - Intergenic
1016720214 6:147287913-147287935 CCTATCACTGGCAAGGACACTGG - Intronic
1016994058 6:149948398-149948420 CCTAAAACAGGCAAGGGGTGGGG - Intronic
1017567712 6:155706311-155706333 CCTAGGACTGGAAAGAGGACAGG - Intergenic
1019109898 6:169701660-169701682 CCTCGCACTAGCACGGCGTCAGG + Intronic
1020265083 7:6555174-6555196 CCTAGCTCTTGCATGGGCTCAGG + Intergenic
1021098599 7:16562333-16562355 CTTAGTACTGGAAAGGGGGCAGG - Intronic
1021449400 7:20769001-20769023 CCAGGTACTGGGAAGGGGTCGGG - Intronic
1023342917 7:39241146-39241168 CCTATTCCTGGCAAGAGGTCTGG + Intronic
1023849383 7:44141641-44141663 TCTTGCACTGGCCAGGGTTCTGG - Intergenic
1023854744 7:44175918-44175940 CTCAGCACTGGCAAGGTCTCTGG + Intronic
1023957088 7:44895112-44895134 GCTGGCCCTGGCCAGGGGTCAGG - Intergenic
1027495927 7:78887941-78887963 CCTGGCAAGTGCAAGGGGTCAGG + Intronic
1028626173 7:92880331-92880353 ACTAGCATTGGCTAGGAGTCTGG + Intergenic
1028727639 7:94106352-94106374 GCTATCATTGGCAAGGGTTCTGG - Intergenic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1030449743 7:109693068-109693090 CCCAGGAAGGGCAAGGGGTCAGG - Intergenic
1030699621 7:112623446-112623468 CCAAGAAGTGGAAAGGGGTCAGG - Intergenic
1031970060 7:128058120-128058142 CCTAGCACTGGCAAGGGGTCAGG - Intronic
1034448823 7:151126696-151126718 CCTGTCACTGGCCAGGGGCCAGG - Intronic
1035622795 8:1046873-1046895 CCAAGCACTGACAATGGGTGAGG - Intergenic
1036173038 8:6508677-6508699 CCTAGCCCTGGCAAGGAGAGGGG - Intronic
1036686665 8:10916134-10916156 TGGAGCACTGGCAAGGGGCCAGG + Intronic
1038177514 8:25194611-25194633 CGAAGCACAGGGAAGGGGTCTGG - Intronic
1038790928 8:30667763-30667785 GCTAGCACTGGCACTGGGACAGG - Intergenic
1040368596 8:46745810-46745832 CCCAGGAATTGCAAGGGGTCAGG - Intergenic
1040736431 8:50513844-50513866 CCTAGGAAGTGCAAGGGGTCAGG - Intronic
1046129975 8:109954768-109954790 CCTAACACAGGAAAGGGGTGAGG - Intergenic
1048258991 8:132929653-132929675 CATAGAACCAGCAAGGGGTCAGG + Intronic
1049562633 8:143319408-143319430 CCTAGCCCTCCCAAGGTGTCTGG + Intronic
1052336471 9:27324869-27324891 CCTAGGAAGTGCAAGGGGTCAGG - Intergenic
1054699622 9:68399710-68399732 CCTAAAACTGACAACGGGTCTGG - Intronic
1055838498 9:80474003-80474025 CCTAGCAGTGGCATGGGGAAGGG + Intergenic
1057076638 9:92141542-92141564 CCTGGCAGTGGCAGGGGGCCGGG - Intergenic
1057952578 9:99381543-99381565 CCTTGCACAGGCAAGGTGTTCGG + Intergenic
1060797300 9:126521691-126521713 CCTGGCACTGGCTGGGGGTGAGG - Intergenic
1061188403 9:129068410-129068432 CCTAGCACTGGCACCAGGGCTGG + Intronic
1185699848 X:2222703-2222725 CCTAGCACTGGTGAGAGTTCAGG + Intronic
1187374548 X:18740064-18740086 CCCAGGAAGGGCAAGGGGTCGGG - Intronic
1188075642 X:25772256-25772278 CCTGGGAATCGCAAGGGGTCAGG - Intergenic
1192313814 X:70036743-70036765 CCTAGAAAGGGCAAGGGGTGAGG + Exonic
1192584290 X:72307370-72307392 CCGGGCACTGGCCAGGGCTCCGG - Intergenic
1195026435 X:100882228-100882250 CCTAGGCCTGGAAAGGGGCCTGG + Intergenic
1197988291 X:132290408-132290430 CCCAGGAAGGGCAAGGGGTCAGG - Intergenic
1198581788 X:138073607-138073629 CCCAGGACGTGCAAGGGGTCAGG + Intergenic
1198985425 X:142446819-142446841 CCAAGCACTGGCAAAGTGGCAGG - Intergenic
1199077874 X:143545034-143545056 CACAGCAGTGGAAAGGGGTCAGG - Intergenic
1199691362 X:150311308-150311330 GCTGGCACTGGAGAGGGGTCAGG + Intergenic